First&year&tutorial&in&Chemical&Biology&(amino&acids,&peptide&and&proteins)&! 1.&!

Similar documents
Transcription:

First&year&tutorial&in&Chemical&Biology&(amino&acids,&peptide&and&proteins& 1.& a. b. c. d. e. 2.& a. b. c. d. e. f. & UsingtheCahn Ingold Prelogsystem,assignstereochemicaldescriptorstothe threeaminoacidsshownbelow. H For each of the amino acids histidine, proline and cysteine, draw the predominant ionisationformsinaqueoussolutionatph1,7and14. Explainwhytheaminoacidcysteineisunstableinair. Definethetermscis$andtrans$asappliedtopeptidestructureandindicatewhich, ifany,oftheseformsusuallydominatesandexplainwhy. Explaintheeffectofincludingaprolineresidueontheconformationofapeptide bond. Giveexamplestoillustratethefollowingfeaturesthatcontributetotheshapeofproteins:& Aminoacidstereochemistry. Thestructureofthepeptidebond. Disulfidelinkages. Hydrogenbonds. ThetorsionalanglesΦandψ. H 2 CO 2 H H Primary,secondaryandtertiarystructure.& & CO 2 H HS H 2 CO 2 H histidine proline cytseine

3.& & + H 3 O OH glycine pk a1 = 2.35 pk a2 = 9.78 a. ExplainwhythepK a1 valueforglycinehydrochloridesaltisdifferentfromthatofacetic acid. b. Definetheterm isoelectricpoint. c. Calculatetheisoelectricpointforglycine. d. ThestructureofarginineispresentedaboveinnonPionicform.Suggestthelikelyionic structureofarginineatphysiologicalph(7.4.giveanexplanationforyourdeduction. 4. ApeptidewassubjectedtoEdmansequencingandcompoundAwasobtained. Ph H 2 S O H H H A & a. UsingcompoundAasanexample,explainthebasisoftheEdmansequencingofpeptides youshouldincludethemechanisminyouranswer. b. IdentifytheaminoPterminusresiduethatgaverisetocompoundA. c. DetailanalternativemethodfordeterminingthePterminalaminoacidofapeptide. d. Detailachemical(nonPenzymaticmethodfordeterminingtheCPterminalaminoacidofa peptide. H 3 C O OH acetic acid pk a = 4.76 H 2 CO 2 H H S H Ph

5. Givemechanismsfortheracemicaminoacidsynthesisshownabove.

First Year Tutorial Questions: Chemical Biology/Enzymology 1. Triose phosphate isomerase (TPI catalyses the conversion of dihydroxyacetone phosphate (DHAP - A to D-glyceraldehyde phosphate (D-GAP - B. a Draw the mechanism of the non-enzymatic reaction, identifying the possible role of acid/base catalysis. b Explain how TPI catalyses the same reaction using its active site residues glutamate-165 and histidine-95. What factors make TPI catalysis favourable? c C and D both inhibit catalysis by TIM. Suggest a mechanism for inhibition in each case. O I OPO 3 2- C OH O - CH 2 OPO 2-3 D

ucleicacidsfirstyearuganswersheet Geneticcodetablewillbesupplied Question1 (idrawwatson2cricka.tandg.cbasepairs,includingthesugarsandphosphatesofda and indicate the major and minor grooves. What is the significance of these grooves in termsofbiologyandtherapeutics? (iidiscusstheforcesthatstabilizedoublestrandedda (iii The nucleobases that occur naturally in DA (A, G, C, T can give 10 possible combinationsofbasepairs.twoofthesearethewatson2cricka.t(ort.aandg.c(orc.g basepairs.theremaining8possibilitiesarecalledmismatchesanddonotnormallyoccurin DA.IfoccurduringreplicationandiftheyarenotremovedbyDArepairenzymesthey giverisetomutations.suggestonestructureforeachofthesemismatchedbasepairsand givereasonswhyeachmightberecognisedbydarepairsystems. Question2 Predict the amino acid sequence of peptides formed by ribozymes in response to the following messengers, assuming each peptide chain begins with the triplet on the left, whichisastartcodon. (a AUGGGUCAGUCGCUCCUGAUU (b AUGUUGGAUGCGCCAUAAUUUGCU (c AUGCACGACGCUUGUUGCUAU (d AUGAUGGACGAA Question3 Whichofthefollowingamino2acidreplacementsinmutantproteinsis/areconsistentwith thegeneticcodeiftheyareduetoasinglepointmutation? (aphetoleu,(biletoleu (calatothr(dprotoser (elystoala (fhistoglu (gphetolys Question4 OnestrandofDAcontainsthefollowingsequencereadingfrom5 2to3 : TCGTCGACGATGATCATCGGCTACTCGA Writedown: (a ThesequenceofbasesintheotherstrandofDA (b ThesequenceofbasesinthemRAtranscribedfromthefirststrandofDAwritten 1

inboldabove. (c Theamino2acidsequencecodedbythemRAin(b Question5 AproteinAofawild2typebacteriumstrain1hasatryptophanresidueatposition26.Strain 2 derived from strain 1 by mutation contains leucine at position 26. Mutation of strain 2 produced strain 3 in which no new mutant protein A was detected and therefore also containsleucineatposition26.mutationofstrain3producedstrain4thatcontainsproline atposition26. (a Assumingthatallmutationswerebasesubstitutionsandthatparentanddaughter strain differ by no more than one base in the codon for residue 26 of protein A, are the observationsinaccordwiththegeneticcode? (b Givetheprogressionofcodonchangesinthisseriesofmutations. (c If a single G.T mismatch occurs during replication, i.e. the daughter strand has a thymine base instead of a cytosine base opposite the G in the original strand, this can produce a mutation. What will be the difference in sequence between the copy of this daughterstrandafteritisreplicatedandthesequenceoftheoriginalstrand? (d Repeat the same exercise assuming that a single G.A mismatch occurs during replication Question6 PCRisthemostwidelyusedmethodofDAamplification.Determinethesequencesfor two20merpcrprimerstoamplifythefollowingshortdatemplateandproduceapcr productofthesamelengthasthetemplate. 5 ACATCGCTCGTACGAACTGAGACTAGTTACAGATACACCCGCTGTGGCCCGCGCTGAGACACATA GCGCTGACAGTAGATGACATACCTCTGGCTCGTTT3 Question7 2

(istructure3representsa2 2deoxy2β2D2ribosesugarwithaDAnucleobaseB(i.e.A,G,C ortattachedatthe1 2position.ItoccursnaturallyinDA.WhichofthetwoDAduplexes (1or2ismadeupfromnucleoside3?Explainyourreasoning. (iiucleosides3and4areβ2anomers.drawthecorrespondingα2anomerof3. 3

First base Middle base Third base (5-end (3-end U C A G U Phe Ser Tyr Cys U Phe Ser Tyr Cys C Leu Ser STOP STOP A Leu Ser STOP Trp G C Leu Pro His Arg U Leu Pro His Arg C Leu Pro Gln Arg A Leu Pro Gln Arg G A Ile Thr Asn Ser U Ile Thr Asn Ser C Ile Thr Lys Arg A Met* Thr Lys Arg G G Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly G *AUG is also used as a start signal.