Supporting Information Self-Powered Electrical Stimulation for Enhancing Neural Differentiation of Mesenchymal Stem Cells on Graphene-Poly(3,4-ethylenedioxythiophene) Hybrid Microfibers Weibo Guo, 1,2 Xiaodi Zhang, 1,2 Xin Yu, 1,2 Shu Wang, 1,2 Jichuan Qiu, 3 Wei Tang,3 Linlin Li, *1 Hong Liu, *1,3 Zhong Lin Wang *1, 4 1 Beijing Institute of Nanoenergy and Nanosystems, Chinese Academy of Sciences; National Center for Nanoscience and Technology (NCNST), Beijing, 100083, P. R. China. 2 University of Chinese Academy of Sciences, Beijing, 100049, P. R. China. 3 State Key Laboratory of Crystal Materials, Shandong University, Jinan, 250100, P. R. China. 4 School of Materials Science and Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332-0245. Corresponding Author: hongliu@sdu.edu.cn; lilinlin@binn.cas.cn; zlwang@binn.cas.cn
This PDF file contents including as follows: S1. SEM images of GO film and PEDOT nanoparticles S2. Real photographs of preparation of the microfibers S3. Real photographs of the microfibers electrodes for I-V test S4. Raman spectrums of PEDOT and FTIR characterizations of GO, PEDOT, rgo and 15% rgo-pedot S5. The adsorption of proteins the resultant microfibers S6. The biodegradability of the resultant microfibers S7. The analysis of the purity of the isolated MSCs S8. MSCs adhesion on smooth few-layer graphene film S9. Real photographs of the TENG S10. Real photograph of the self-made cells culture plate for electrical stimulation S11. MSCs stimulated by linear motor triggered TENG S12. Sequences of Real-Time PCR primers
S1. SEM images of GO film and PEDOT nanoparticles Figure S1. SEM images of GO film (a) and PEDOT nanoparticles (b). From the SEM image of GO (a), the GO sheets can uniformly spread on a flat platform like ripples, and the SEM image of PEDOT nanoparticles (b) shows the size of PEDOT nanoparticles is about 50 nm. S2. Real photographs of preparation of the microfibers Figure S2. (a) Photograph of about 1 m long glass pipelines (0.8 mm in inner diameter) filled with 8 mg/ml aqueous graphite oxide (GO) suspension and GO suspension with 15% volume of PEDOT nanoparticles solution. Photographs of obtained rgo microfiber before (b) and after (c) natural drying.
S3. Real photographs of the microfibers electrodes for I-V test Figure S3. Photograph of the microfibers electrodes for I-V test S4. Raman spectrums of PEDOT and FTIR characterizations of GO, PEDOT, rgo and 15% rgo-pedot Figure S4. Raman spectrums of PEDOT (a) and FTIR characterizations of GO, PEDOT, rgo and 15% rgo-pedot (b) S5. The adsorption of proteins the resultant microfibers Figure S5. (a) FTIR characterizations of rgo microfiber and 15% rgo-pedot hybrid microfiber; (b) adsorption of BSA, proteins from FBS and fibronectin on rgo microfiber and 15% rgo-pedot hybrid microfiber. ( # р 0.05, ## р 0.01, n=3) Graphene and its derivatives have been shown to possess an enhancing degree of cell adhesiveness and proliferation from reduced graphene oxide to graphene-based
composites. Shi and coworkers demonstrated that cell performance decreased significantly as the reduced graphene oxide was highly reduced, because of the surface oxygen content of rgo has a significant influence on cellular behaviors. From the FT-IR spectra of rgo microfiber and 15% rgo-pedot hybrid microfiber (Figure R9a), the carboxylic C=O (1740 cm -1 ) and O-H (3300 cm -1 ) peaks intensity of 15% rgo-pedot hybrid microfiber are higher than that of rgo microfibers, so the cross-linking process of GO with PEDOT induces a lower reducing degree of the 15% rgo-pedot hybrid microfiber during the hydrothermal reaction. According to the above discussion, the 15% rgo-pedot hybrid microfiber should have a better protein adsorption ability than rgo microfiber. The protein adsorption ability of rgo microfiber and 15% rgo-pedot hybrid microfiber were investigated. The adsorption of individual proteins of fibronectin and bovine serum albumin (BSA, Sangon Biotech), as well as fetal bovine serum (FBS, Gibco) that contains multiple kind of serum proteins were examined on rgo microfibers and 15% rgo-pedot hybrid microfibers. In detail, 10 mg rgo microfibers or 15% rgo-pedot hybrid microfibers was immersed in 0.5 ml FBS solution, 200 µg/ml BSA in PBS and 20 µg/ml fibronectin in Tris-HCl buffer. The adsorption was conducted in a sterile humidified incubator at 37 C for 24 h, and then the adsorbed proteins were removed from the microfibers by 2% sodium dodecyl sulfate (SDS). The total protein was quantified using a Micro BCATM Protein Assay Kit (Thermo Scientific, USA) following the manufacturer's instruction. BCA quantitative measurement (Figure R9b) indicates that the amount of adsorbed proteins of fibronectin BSA and FBS on 15% rgo-pedot hybrid microfiber are ~1.24-fold ~1.17-fold and ~1.16-fold and higher that of on rgo microfiber, respectively. The results show that the biomolecules are nonspecifically and physically adsorbed on the surface of rgo microfiber and 15% rgo-pedot hybrid microfiber. The higher content of oxygen-containing group makes 15% rgo-pedot hybrid
microfiber a better protein adsorption ability than rgo microfiber, which is beneficial for the cells adhesion and proliferation. S6. The biodegradability of the resultant microfibers Figure S6. Low-resolution (1) and high-resolution (2) SEM images of rgo microfibers (a) and 15% rgo-pedot hybrid microfibers (b) before and after the incubation with HRP-H 2 O 2 for 21 days; Raman spectra depicting (c) rgo microfiber and (d) 15% rgo-pedot microfiber after 7 (black), 14 (blue) and 21 (red) days of incubation with HRP-H 2 O 2 ; (e) the percentage of residual mass of the rgo microfibers and 15% rgo-pedot hybrid microfibers after HRP-induced oxidization at day 7, 14 and 21. ( # р 0.05, ## р 0.01, n=3) In previous studies, GO has been reported to be biodegradable by horseradish peroxidase (HRP) in the present of H 2 O 2, which could be completed degraded in 4 days, however, because of the lack of holey structures on the basal plane and the oxygen-containing groups, the HRP-induced oxidation was invalid for the highly chemical reduced GO (such like hydrazine hydrate reduced GO). In our work, the rgo microfibers were obtained by hydrothermal process without any chemical
reducing agent, and the SEM, FTIR and Raman spectra characterizations indicated that the as-prepared rgo microfiber and 15% rgo-pedot hybrid microfiber are of surface nanoporous structured, rich in oxygen-containing groups and have low graphitization extents. We deduce the as-prepared microfibers may provide bonding active sites with HRP. In this study, 10 mg rgo microfibers or 15% rgo-pedot hybrid microfibers were incubated with 5 ml of 500 µg/ml HRP and 0.5 ml of 1 mm H 2 O 2 at ph 7.4 in phosphate buffer for 21 days at 37 C. 20 µl of 10 mg/ml fresh HRP and 20 µl of 0.1 M H 2 O 2 were added daily to complement the decay of HRP activity and the consumption of H 2 O 2. SEM images of the rgo microfiber (Figure S6a) and 15% rgo-pedot hybrid microfiber (Figure S6b) after 21 days incubation with HRP-H 2 O 2 were shown to present the morphology changes of the microfibers. After 21 days of incubation, the low-resolution SEM images of the rgo microfibers and the 15% rgo-pedot microfibers show the microfibers turned into high-roughness structures, and the high-resolution SEM images indicate that their nanopores on the surface are degraded down. The Raman spectroscopy and residual mass were also be used to analyze the biodegradation of rgo microfibers (Figure S6c) and 15% rgo-pedot hybrid microfibers (Figure S6d) on day 0, 7, 14 and 21 of incubation. Raman spectra show a decreasing tendency of the characteristic Raman peaks of D band and G band, demonstrating the increase in the number of defect sites as a result of HRP catalyzed oxidation of the graphitic lattice. The percentage of residual mass (Figure S6e) also illustrates the biodegradation behaviors of the rgo microfibers and 15% rgo-pedot
hybrid microfibers indicate that both of the microfibers are biodegradable. After 7 days of enzymatic degradation, the residual mass of the rgo microfiber is approximately 96.05±2.41%, and the residual mass of the 15% rgo-pedot hybrid microfiber is approximately 96.45±2.38%. The residual mass of both microfibers decreased with an increase in enzymatic degradation time. After 14 days, the residual mass of the rgo microfiber was approximately 91.02±3.15%, the 15% rgo-pedot hybrid microfiber remained at 90.01±2.46%. At day 21 the residual mass of rgo microfiber and 15% rgo-pedot hybrid microfiber is 86.43±2.83% and 85.12±1.39%, respectively. The above results suggesting an obviously degradation of as-prepared microfibers by the HRP-induced oxidization. Because neural regeneration is a long process, the results suggest that the rgo-pedot hybrid microfiber with low degradation rate could be consistent with the long-term neural regeneration process. S7. The analysis of the purity of the isolated MSCs Figure S7. Flow cytometry purity analysis of the MSCs. Red peak, the control of mouse IgG. Green peak, CD45 (a), CD54 (b), CD90 (c) staining. MSCs express CD54 and CD90, but not CD45. The result showed that 97.42% of the cells were CD45 negative, 99.0% were CD54 positive and 96.2% were CD90 positive, we can calculate that the purity of the MSCs was over 90%.
S8. MSCs adhesion on smooth few-layer graphene film Figure S8. (a) Digital photograph of few-layer graphene on the glass substrate, graphene is within maker I boundaries, graphene and marker II are on the top side of glass slide maker I is on the bottom side of glass slide; (b) Atomic force microscopy (AFM) of the graphene film; (c) bright filed microscope photograph of the graphene film without cells (scale bar = 10 µm); (d) fluorescence micrograph of MSCs after 3 days of normal culturing on the graphene film. The actin filaments of the cells were stained by Alexa-fluor488-phalloidin with an excitation wavelength at 488 nm (green) and nuclear staining with DAPI (blue) (scale bar = 100 µm). The graphene were transferred onto a glass substrate (Figure S8a, c). From the AFM characterization (Figure S8b), the graphene film was about 20 nm in thickness. The smooth graphene film substrate (located at the marker I region) was coated with poly-d-lysine (PDL) and laminin before MSCs seeding with the same cell seeding density as rgo microfiber, and in our manuscript the microfibers were uncoated with PDL or laminin. After 3 days of normal culture, the cells were observed by actin
cytoskeleton staining (Figure S8d). The cells didn t cover all the region of the graphene film, which has a much lower cell-cell connection than that of on the rgo fiber and 15% rgo-pedot hybrid microfiber (Figure 3). S9. Real photographs of the TENG Figure S9. Photograph of the as-fabricated TENG S10. Real photograph of the self-made cells culture plate for electrical stimulation Figure S10. Photograph of the self-made cells culture plate The MSCs can't adhere on the surface of a culture plate with untreated hydrophobic surface, which is only for bacteria culturing.
S11. MSCs stimulated by linear motor triggered TENG Figure S11. Cells were immunostained with (1) DAPI (blue) for nucleus and neural-specific antibodies (2) Tuj1 (red, cy3), (3) GFAP (green, FITC) with linear motor triggered TENG electrical signals stimulation for 21 days on rgo microfiber (a) and 15% rgo-pedot hybrid microfiber (b). (4) The merged fluorescence images. (Scale bar = 100 µm). S12. Sequences of Real-Time PCR primers Gene Forward primers (5'-3') Reverse primers (5'-3') GAPDH GCCTCGTCTCATAGACAAGATGGT GAAGGCAGCCCTGGTAACC Tuj1 TAGACCCCAGCGGCAACTAT GTTCCAGGCTCCAGGTCCACC GFAP CGGAGACGTATCACCTCTG TGGAGGCGTCATTCGAGACAA Table S1. Sequences of Real-Time PCR primers Captions for supporting Movies Movie 1. This movie shows the rotation video of the MSCs cultured on rgo microfiber for 72 h and stained with Actin (green) and DAPI (blue). Movie 2. This movie shows the rotation video of MSCs differentiated on 15% rgo-pedot hybrid microfiber for 72 h and immunostained with Actin (green) and DAPI (blue).