JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 1992, p. 2835-2841 0095-1137/92/112835-07$02.00/0 Copyright X 1992, American Society for Microbiology Vol. 30, No. 11 Identification of Meningococcal Serosubtypes by Polymerase Chain Reaction MARTIN C. J. MAIDEN, JANE A. BYGRAVES, JAMES McCARVIL, AND IAN M. FEAVERS* National Institute for Biological Standards and Control, South Mimms, Potters Bar, Hertfordshire, United Kingdom, EN6 3QG Received 30 April 1992/Accepted 14 August 1992 The polymerase chain reaction was used as the basis of a novel typing method for Neisseria meningitidis. Southern hybridization experiments demonstrated that it was possible to identify genes encoding different serological variants of the meningococcal class 1 outer membrane protein by probing with polymerase chain reaction products corresponding to known epitopes. A set of 14 defined variable regions was prepared in bacteriophage M13mpl9 by the cloning of polymerase chain reaction products. The phage were dot blotted onto membrane ifiters, which were used as targets for hybridization of radiolabeled amplified class 1 outer membrane protein genes. Thus, the presence of many different subtype-specific epitopes could be investigated in one experiment. This technique was evaluated with a set of serological reference strains, mainly of serogroup B organisms, and provided an alternative, rapid, and comprehensive typing system that was capable of distinguishing known serosubtypes and also of defining currently untypeable strains independently of sodium dodecyl sulfate-polyacrylamide gel electrophoresis or serological analysis. An additional advantage of this technique was that in the case of an unknown serosubtype (i.e., one that did not hybridize with any of the known samples), the DNA amplified from the original sample could be used to deternine the nucleotide sequence of the novel serosubtype and to clone the corresponding variable region into bacteriophage M13. It may be possible to develop this procedure for the diagnostic detection and typing of meningococci directly from clinical samples even when culture is not possible because of antibiotic treatment of an acute case. Neisseria meningitidis is a pathogen of worldwide significance (22). It is an antigenically complex organism with a range of molecular mechanisms for initiating antigenic changes in particular cell surface components. Many of these components exhibit phase variation (20) and thus are of little use in typing systems for epidemiological studies. The following surface components are used in typing systems, and their value in epidemiological analyses is well established (6): the polysaccharide capsular antigens define the serogroup (3, 8, 27), the class 2 and 3 outer membrane proteins (OMPs) define the serotype, and the variable epitopes of the class 1 OMP define the serosubtype (1, 10, 11, 16, 18) of a given isolate. The current serotyping and serosubtyping systems for meningococci are largely dependent on monoclonal antibodies (1, 14). Typing with these reagents requires multiple assays, and the complete range of antigenic variation is not covered. Serogroup A meningococci, which are largely responsible for pandemic outbreaks (2), are poorly defined by monoclonal antibodies, and a substantial proportion of isolates of serogroups B and C, the other major diseasecausing serogroups, are currently described as untypeable. Recent studies of the structures of the genes encoding the class 1, 2, and 3 major OMPs of meningococci and related proteins have provided much information on the structural bases for the antigenic variability of these proteins and have enabled models of their secondary structure to be predicted (5, 9, 10, 16, 26). In addition, the epitopes recognized by some of the monoclonal antibodies used for serosubtyping have been identified by the analysis of overlapping peptides (18). These epitopes are located in at least two of the variable * Corresponding author. 2835 regions (VRs) (VR1 to VR3) (16) of the protein sequence, with the majority of the peptide sequence variation found in VR1 and VR2; in some cases, the VRs have been shown to contain continuous epitopes (16, 18). In the present work, an alternative DNA-based approach for the subtyping of meningococcal isolates has been developed and evaluated against a panel of predominantly serogroup B reference strains. The method was based on knowledge of the nucleotide sequences of antigenic variants of the class 1 OMP. The gene encoding the class 1 OMP gene was amplified by polymerase chain reaction (PCR), and the resulting product was labeled and hybridized to reference DNA samples immobilized in an ordered array on a membrane filter. The epitopes encoded by the target gene were revealed by autoradiography of this filter. MATERIALS AND METHODS Strain maintenance and DNA preparation. Strains of N. meningitidis were obtained from D. M. Jones, Withington Hospital, Manchester, United Kingdom; J. T. Poolman, Rijksinstituut voor Volksgezondheid en Milieuhygiene, Bilthoven, The Netherlands; and M. Achtman, Max-Planck Institut fur molekulare Genetik, Berlin, Germany. The NIBSC identification numbers, strain numbers, serogroups, serotypes, and subtypes are given in Table 1. These strains were maintained at -70 C in Mueller-Hinton broth plus freezing mix (glycerol, 10%; sodium citrate, 3 mm; ammonium sulfate, 1 mm; potassium phosphate, 100 mm; ph 6.6) and propagated on heated blood (chocolate) agar at 37 C in a 5% CO2 atmosphere for between 8 and 16 h. Growth from five chocolate agar plates was scraped into TE buffer (10 mm Tris-HCl, 1 mm EDTA, ph 8.0; 5 ml) to which TNE buffer (100 mm Tris-HCl, 100 mm NaCl, 10 mm EDTA, 1%
2836 MAIDEN ET AL. J. CLIN. MICROBIOL. TABLE 1. N. meningitidis strains used in this work Geographical location and NIBSC no. Strain no. Serogroup Serotypea Subtype yr of isolation or Sourcec reference" 2001 M1080 B 1 P1.1,7 25 PHLS 2002 M990 B 6 P1.6 25 PHLS 2003 B16.B6 B 2a P1.2 13 PHLS 2004 M982 B 9 P1.9 25 PHLS 2005 2996 B 2b P1.2 12 PHLS 2006 35E C NT P1.1 12 PHLS 2007 S3032 B 12 P1.12,16 25 PHLS 2008 H355 B 15 P1.15 25 PHLS 2054 G2093 B NT NT Coventry, UK (1986) PHLS 2058 J143 B 15 P1.16 Doncaster, UK (1988) PHLS 2063 4076 B 15 P1.16 Stonehouse, UK PHLS 2072 4118 B 15 P1.16 Stonehouse, UK PHLS 2128 K994 B 15 P1.7,16 1989 2131 B ND ND Rugby, UK (1989) 2147 L1837 B NT NT Nottingham, UK (1990) PHLS 2148 L1948 B NT NT Basildon, UK (1990) PHLS 2149 L1818 B NT NT Hereford, UK (1990) PHLS 2150 L1886 B NT NT Liverpool, UK (1990) PHLS 2214 870227 4 P1.10 RIVM 2215 S3446 14 P1.6,14 RIVM 2216 82066 P1.4 RIVM 2151 B40 A NT P1.10 Morocco (1967) MPI a NT, nontypeable by serosubtyping monoclonal antibodies; ND, not done. b UK, United Kingdom. c PHLS, Public Health Laboratory Service, Withington Hospital, Manchester, United Kingdom; RIVM, Rijksinstituut voor Volksgezondheid en Milieuhygiene, Bilthoven, The Netherlands; MPI, Max-Planck Institut f(ir Molekulare Genetik, Berlin, Germany. Sarkosyl, ph 7.5; 5 ml) was added, proteinase K was added OMP gene (10, 19) in regions corresponding to the N- and to a final concentration of 100,ug/ml, and the mixture was C-terminal ends of the mature protein. Primers for amplifiincubated at 55 C for 2 h. Sequential extractions were then cation of the parts of the class 1 OMP (pora) gene corredone with equal volumes of phenol (saturated with TE sponding to each of the VRs of the class 1 protein sequence buffer), phenol-chloroform (1:1; saturated with TE buffer), were designed on the basis of the consensus sequence of and chloroform. Boiled RNase A (Sigma Chemical Co.) was Maiden et al. (16) and were designated primers 74 and 75 added, the extract was incubated for 2 h at room tempera- (VR1) and 83 and 84 (VR2). These primers were designed to ture, and sequential phenol-chloroform and chloroform ex- include recognition sites for the restriction endonuclease tractions and dialysis against two overnight changes of 0.1 x BgllI to facilitate cloning of the PCR products. T'E buffer were performed. The DNA concentration and purity were spectrophotometrically. PCR. PCR components were as follows: template (menin- Ouigedeterminedsprie Oligodeoxrbonucleotide primer sequences. Oli-. Oligodeoxyri-. gococcal chromosomal DNA, prepared as described above), 5 g~l 0m rshi H80 0m C;15m bonucleotides were synthesized on an Applied Biosystems 50 ng/l.d; 10 mm Tris-HCl, ph 8.0; 50 mm KCl; 1.5 mm 381A DNA synthesizer. The nucleotide sequences of the MgCl2; 0.1% gelatin; 200 p,m each datp, dctp, dgtp, and primers used are given in Table 2. Primers 8U, 21, and 22 dttp; the required primers at 2 p,m; and 0.5 U of Taq were complementary to the nucleotide sequence of the class polymerase (Cetus Corp.). The reaction mixtures were incu- 1 OMP gene and have previously been described (16). bated for 30 cycles in a PHC-2 programmable heat block Primers 27 and 28 were in equivalent locations of the class 2 (Techne Instruments Ltd.) for 2 min at 94 C, 2 min at 60 C, TABLE 2. Nucleotide sequences of primers Primer Type of OMP gene target Direction' Nucleotide sequence 8U Class 1 F TCCGTACGCTACGATTCTCC 21 Class 1 F CTGTACGGCGAAATCAAAGCCGGCGT 22 Class 1 R TTAGAATTTGTGGCGCAAACCGAC 27 Class 2 or 3 F TTGTACGGTACAATTAAAGCAGGCGT 28 Class 2 or 3 R TTAGAATTTGTGACGCAGACCAAC 74 Class 1 VR1 F GAGGAAGGCAGGAACTCATCCAGCTGCAATTG 75 Class 1 VR1 R GAAATCGCTGATTTTAOATGTCCTGATGCGGCT 83 Class 1 VR2 F CCGGCCCAAAACAGCTACCGCCTATACGCCGGCT 84 Class 1 VR2 R GGCATAATACACATCA4ATGGCTTGTCGACAACAGC 122L Class 1 R GGCGAGATTCAAGCCGCC a F and R, forward and reverse orientations, respectively, of the primer in relation to the direction of transcription of the gene.
VOL. 30, 1992 and 3 min at 72 C. After 30 cycles, the reaction mixtures were incubated for a further 3 min at 72 C. Restriction digestion, agarose gel electrophoresis, and DNA transfer. The products of PCRs and M13mpl9 vector were digested with restriction endonucleases essentially as described by Maniatis et al. (17) with restriction endonucleases and buffers supplied by New England BioLabs. Samples of DNA were separated on agarose gels (between 0.7 and 2%, depending on the expected fragment size) in 40 mm Trisacetate-1 mm EDTA (ph 8.0) at 50 to 100 ma. For Southern hybridization, agarose gels were blotted with a Vacugene vacuum blotting unit (Pharmacia-LKB) onto nylon membrane filters (GeneScreen; DuPont). The filters were fixed by irradiation with UV light of 254-nm wavelength for 4 min. Nylon membranes were also used for dot blot experiments. Each DNA sample (500 ng; diluted in 100,ul of 2x SSC [lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate]) was placed in a well of a dot blot manifold (BioRad) and drawn onto the membrane filter with a vacuum of 40 cm of H20. Each well was washed twice with 2x SSC. The filter was removed and fixed by UV-light irradiation as described above. Preparation of radiolabeled probe DNA. Probes of the specific variable sequences used in Southern hybridizations were produced by end filling the PCR products obtained by using primers 74 and 75 (VR1) or primers 83 and 84 (VR2) with DNA polymerase (Klenow fragment; Boehringer Corp.) and [a-32p]datp as label. For the dot blot experiments, radiolabeled VR1 and VR2 DNAs were prepared by precipitation of the relevant PCR products with polyethylene glycol 8000 (37 C, 15 min) and sedimentation in a microfuge for 10 min to remove PCR primers. The purified class 1 gene fragments were primer extended with primers 21 and 8U (16), with [a-32p]datp incorporated into the extension mixture. Both types of radiolabeled probe were purified from unincorporated radioactive nucleotide on Sepharose G50 spun columns as described by Maniatis et al. (17). DNA-DNA hybridization. Prior to hybridization, the filters were soaked in 4x SET buffer (17) for 1 h at 42 C. Prehybridization was for 1 h in 4x SET buffer plus 0.1% sodium pyrophosphate, 50% formamide, 0.2 mg of heparin per ml, and 2% sodium dodecyl sulfate (SDS) at the hybridization temperature. For hybridization, radiolabeled probe was heated to 100 C for 2 min, added to 2 ml of prehybridization mixture, and incubated with rotation overnight at between 42 and 60 C, depending on the experiment, in a hybridization oven (Appligene). The filters were washed twice in 4x SET buffer with 0.1% SDS at room temperature, rewashed at 65 C in O.lx SET buffer with 0.1% SDS, and autoradiographed at -70 C with an intensifying screen on Hyperfilm (Amersham International). Cloning and nucleotide sequencing of VRs. To prepare VR-encoding DNA clones, appropriate PCR products were made (using primers 74 and 75 for VR1 and primers 83 and 84 for VR2; Table 2). The amplified products were digested with the restriction endonuclease BglII and purified by agarose gel electrophoresis, and the DNA fragments were cloned into the BamHI site of the bacteriophage M13mpl9 vector. The nucleotide sequences of these clones were determined with modified bacteriophage T7 DNA polymerase (24), Sequenase kits, and the M13 universal primer (United States Biochemical Corp.) used in accordance with the manufacturers' instructions. The M13 clones used contained recombinant DNA in the same orientation, the antisense strand. Thus, in a hybridization, the single-stranded MENINGOCOCCAL SEROTYPING BY PCR 2837 Sample - Meningococcal DNA, Cells PCR Amplification of class 1 OMP gene Radiolabel by primer extension Hybridise to filter with standard VRs Wash, expose Result VR1VR2 FIG. 1. Scheme for the typing of meningococcal strains by PCR. The nucleotide sequence encoding the mature class 1 OMP gene is amplified, with appropriate primers, from meningococcal samples (DNA or cells) by PCR. Primer extension is carried out on the amplified gene with primers specific for VR1 and VR2 in the presence of radioactive ATP to produce VR-specific radiolabeled probes. These probes are hybridized to standard DNA samples blotted onto nylon membranes. The membranes are washed, and the VRs present in the samples are determined by autoradiography. M13 phage DNAs would hybridize to the sense (coding) strand of the gene. The nucleotide sequences encoding novel VRs were determined by a direct nucleotide sequencing method (7). The region of the pora gene encoding the mature class 1 OMP was amplified by PCR with primers 21 and 22 as described previously (16), and the part of the gene encoding the major VRs was sequenced from primers 21, 8U, and 122L (Table 2). DNA dot blot subtyping scheme. DNA-based subtyping is shown in Fig. 1. A reference collection of VR clones was prepared in M13mpl9 (29). This collection contained all the unique VR sequences from reference strains NIBSC2001 through NIBSC2008 and from NIBSC2151 and represented most of the known epitopes and some VRs for which no monoclonal antibody had been defined. The single-stranded forms of the clones were bound to nylon filters by using a dot blot manifold with the VR1 clones in one column and the VR2 clones in another. Filters were probed with the PCRamplified labeled class 1 OMP gene from the untyped meningococcal isolate and washed, and the results were visualized by autoradiography of the filter. RESULTS Discrimination of VRs by Southern hybridization. The OMP genes were amplified from four strains (NIBSC2001,
2838 MAIDEN ET AL. C s I I3 4 '. 3.4 S S It 2'-' 3 4 S i.) 2s i 2 3 4 S TABLE 3. J. CLIN. MICROBIOL. M13 clones of DNA encoding VRs of various class 1 OMPs M13 M13 ClOne clone VR ~~~~~Strain (NIBSCno.) no.epte EPitOPe 1/A 1 2996 (2005) P1.5 1/B 1 M1080 (2001) P1.7 1/C 1 S3032 (2007) P1.12 1/D 1 H355 (2008) 1/E 1 M982 (2004) 1/F 1 35E (2006) 1/G 1 M990 (2002) 2/A 2 35E (2006) P1.1 2/B 2 2996 (2005) P1.2 2/C 2 M982 (2004) P1.9 2/D 2 B40 (2151) P1.10 2/E 2 H355 (2008) P1.15 2/F 2 S3032 (2007) P1.16 2/G 2 M990 (2002) FIG. 2. Southern hybridization discriminates between genes encoding antigenic variants of the class 1 OMP. (A) Agarose gel analyses of PCR-amplified class 1 and class 2 or 3 OMP genes from strains NIBSC2001 (P1.1,7; lane 1), NIBSC2006 (P1.1; lane 2), NIBSC2007 (P1.12,16; lane 3), and NIBSC2128 (P1.7,16; lane 4). (B) Southern hybridization analysis of gel similar to that in panel A probed with PCR-amplified VR1 from the class 1 OMP gene of strain NIBSC2001 (P1.7 epitope). (C) Like panel B but probed with VR2 of strain 2001 (P1.1 epitope). (D) Like panel B but probed with VR2 of strain 2007 (P1.16 epitope). Lanes S, molecular size markers. P1.7,1; NIBSC2006, P1.1; NIBSC2007, P1.12,16; and NIBSC2128, P1.7,16; Table 1) with primers 27 and 28 at low stringency. Each of these strains had a different combination of VRs, some of which encoded subtypeable epitopes. Amplification with these primers at low stringency ensured that both the class 1 and the class 2 or 3 OMP genes (depending on the strain) were amplified (10). The reaction products were separated by agarose gel electrophoresis and visualized by ethidium bromide (Fig. 2A). Three similar gels were blotted onto nylon membranes, and each of the membranes was probed with radiolabeled DNA corresponding to a specific VR. The bands corresponding to the class 1 OMP gene from strains NIBSC2001 and NIBSC2128 hybridized only to the VR1 probe PCR amplified from NIBSC2001 (Fig. 2B), whereas the VR2 probe amplified from this strain hybridized to class 1 genes from strains NIBSC2001 and NIBSC2006 (Fig. 2C). The VR2 probe amplified from NIBSC2007 hybridized specifically to the class 1 genes of strains NIBSC2007 and NIBSC2128 (Fig. 2D). There was no cross-hybridization with the class 2 or 3 OMP genes. Cloning and sequence analysis of VRs. A list of the VRs present in each of the 14 bacteriophage M13 clones is given in Table 3. The nucleotide sequences of these clones confirmed previously published data (16). The VR2 from strain 2151 (P1.10) had not previously been described and was confirmed by the direct sequence analysis of the class 1 OMP gene from this strain (see Table 5). Identification of VRs by dot blot analysis. The dot blot procedure was optimized for the identification of each of the VRs present in the reference strains (NIBSC2001 through NIBSC2008). Hybridization was carried out at a range of temperatures (data not shown). A greater degree of discrimination was obtained by varying the hybridization instead of the washing stringencies. Although each VR behaved differently, there was in general a high level of nonspecific signal when a hybridization temperature of 42 C was used, whereas at 60 C, there was an unacceptable loss of signal and specificity. A temperature of 50 C was chosen because it gave the best specificity and sensitivity across the range of strains. The results of the procedure for each of the reference strains are shown in Fig. 3. These results were obtained after 4 h of autoradiography; the specificity of the result was unchanged after overnight exposure. Analysis of untypeable strains. To evaluate the dot blot subtyping procedure further, a number of clinically isolated strains were typed by the new dot blot method (Table 4). In all but three of these isolates, in which only one VR was identified, both VRs were recognized by the dot blot method. Eight of these strains had previously been analyzed A (* I) L. I. G FIG. 3. Subtyping of eight serological refcrence strains by dot blot analysis. A series of reference DNAs with specific VR1 and VR2 nucleotide sequences cloned into M13mp19 phage (Table 3) were dot blotted onto GeneScreen membranes arranged in two columns and seven rows. Probes consisting of PCR-amplified class 1 and class 2 or 3 genes from each of strains NIBSC2001 through NIBSC2008 (Table 1) were prepared as described in Materials and Methods and hybridized to the membranes (50% formamide, 0.6 M NaCl) at an annealing temperature of 50 C. PCR-amplified OMP genes from the following strains were used as probes: (A) NIBSC2001 (P1.1,7); (B) NIBSC2002 (P1.6); (C) NIBSC2003 (P1.2); (D) NIBSC2004 (P1.9); (E) NIBSC2005 (P1.2); (F) NIBSC2006 (P1.1); (G) NIBSC2007 (P1.12,16); (H) NIBSC2008 (P1.15).
VOL. 30, 1992 TABLE 4. Subtyping of strains by dot blot analysis M13 clone NIBSC hybridizeda Epitope deduced Subtype determined strain from dot blot serologically" VR1 VR2 2054 1/D 2/E P1.-,15 NT 2058 1/B 2/F P1.7,16 P1.16 2063 1/B 2/F P1.7,16 P1.16 2072 1/B 2/F P1.7,16 P1.16 2131 1/D 2/E P1.-,15 ND 2147 1/B NH P1.7,- NT 2148 1/A 2/D P1.5,10 NT 2149 1/B NH P1.7,- NT 2150 1/D NH P1.-,- NT a NH, no hybridization. bserosubtyped at the Meningococcal Reference Laboratory, Withington Hospital, Manchester, United Kingdom. ND, not determined; NT, not subtypeable by this method. for serosubtype by using monoclonal antibodies (strain NIBSC2131 had not been serosubtyped). Strains NIBSC 2058, NIBSC2063, and NIBSC2072 were known to have the P1.16 subtype, and the remaining strains were nontypeable by monoclonal antibodies. In five of the isolates, dot blot analysis revealed the presence of the nucleotide sequence encoding a P1.7 epitope that had not been detected by the monoclonal antibody subtyping reagents. Identification of novel subtype-specific nucleotide sequences. To extend the range of the dot blotting procedure, several previously undefined VRs were subjected to direct nucleotide sequence analysis. These sequences and their corresponding amino acid sequences are listed in Table 5. The P1.10 epitope cloned from strain 2151 was sequenced both from the M13 clone 2/D (Table 3) and directly from the PCR product. VR1 of strain NIBSC2214 differed by only one base from the P1.5 sequence in clone 1/A (Table 3), while VR2 in this strain was identical to the P1.10 sequence in clone 2/D. VR1 of strain NIBSC2216 encoded the P1.7 epitope, and the nucleotide sequence encoding the P1.4 epitope was determined by sequencing VR2 from the class 1 OMP gene in this strain. Both VR1 and VR2 of strain NIBSC2215 were novel. MENINGOCOCCAL SEROTYPING BY PCR 2839 DISCUSSION Previous work has shown that by using a pair of primers for the class 1 OMP gene, one of which was specific for a VR, PCR could be used to distinguish the subtype of a meningococcal strain (16, 23). This approach, however, was not suitable for routine application for two reasons: separate PCR amplifications with many different sets of primers were necessary, and high annealing temperatures that varied from one VR to another were required for discriminating between primers with similar sequences. The DNA dot blot technique was developed as a more-appropriate method for the routine subtyping of clinically important meningococcal isolates. Southern hybridization experiments demonstrated that VR-specific probes could be used to identify the epitopes encoded by serologically different strains (Fig. 2). Although this approach was potentially an alternative to subtyping meningococci, it suffered the disadvantage that each strain to be subtyped required repeated blotting with an extensive collection of VR-specific DNA probes (Fig. 1). The dot blot procedure overcame this problem by probing a reference collection of cloned VRs bound to a nylon filter in an ordered array, with the labeled class 1 OMP gene amplified by PCR from the untyped isolate. A single PCR was required for each isolate tested, and a maximum of three universal primers were needed to subtype any meningococcus. This technique was shown to be robust when tested with both serological reference strains and clinical isolates. The results were normally obtained after 4 h of autoradiography, and the specificity remained unchanged after overnight exposure. Analysis of strains that had proved difficult or impossible to subtype by the use of monoclonal antibodies (Table 4) showed that the dot blot analysis was more reliable, detecting at least one and usually both VRs in each strain examined. In addition, the dot blot procedure detected VRs, such as VR1 in strains NIBSC2054 and NIBSC2131, against which no corresponding monoclonal antibody has been isolated. A further advantage of this system is that newly defined VRs for which monoclonal reagents are not available can be readily cloned and incorporated onto the dot blot membrane directly from the PCR. The method also circumvents problems that arise from protein structure or the effects of other cell surface components. For example, in TABLE 5. Previously unpublished nucleotide sequences of VRs determined in this study NIBSC VW Sequence Epitope strain(s) A Q A A N G G A S G Q V K V 2147 + 2149 1 GCA CAA GCC GCT AAC GGT GGA GCG AGC GGT CAG GTA AAA GTT P1.7 P L P N I Q P Q 2214 1 CCG CTC CCA AAT ATT CAA CCT CAG Q P S R T Q G Q T S N Q V K 2215 1 CAA CCC TCA AGA ACT CAA GGT CAA ACG AGC AAT CAG GTA AAA A Q A A N G G A S G Q V K V T K V 2216 1 GOCA CAA GCC GOCT AAC GGT GGA GCG AGC GGT CAG GTA AAA GTT ACT AAA GTT P1.7 T L A N V A N T N I G V P 2150 2 ACC CTT GOCT AAT GGT GOCT AAT ACA ATT ATC GGC GTT CCOG H F V Q N K Q N Q R P T L V P 2214 + 2151 2 CAT TTT GTT CAG AAT AAG CAA AAT CAG CGG CCT ACT CTC GTT CCG P1.10 Y V D E K K ML V H A 2215 2 TAT GTG GAT GAG AAG AAA ATG GTT CAT GCG H V V V N N K V A T H V P 2147 + 2216 2 CAT GTT GTT GTG AAT AAC AAG GTT GOCT ACT CAC GTT CCG P1.4 a The VR1 and VR2 nucleotide sequences are located from positions 34 to 89 and 502 to 548, respectively, in the published consensus sequence of pora.
2840 MAIDEN ET AL. five of the strains listed in Table 4, the dot blot analysis detected the nucleotide sequence encoding P1.7 epitope variants that were not identified by the monoclonal antibodies. The failure to detect this epitope by serological means may be related to the deletion of three codons (lysine-valinethreonine) that are repeated at the promoter-distal end of the VR1 and that encode some P1.7 epitopes. Besides confirming the primary structure of P1.10, nucleotide sequence analysis of the PCR products of the class 1 OMP genes from three additional serotyping reference strains (NIBSC2214, NIBSC2215, and NIBSC2216) identified four previously uncharacterized VRs; two were located in VR1, and two were located in VR2. All the VRs of strain NIBSC2215, including the less frequently variable VR3, were novel, making it impossible to assign the P1.6 and P1.14 epitopes unambiguously to a particular continuous epitope. A comparison of this sequence with the previously published P1.6 class 1 OMP gene from strain NIBSC2002 (16) suggested that P1.6 may be a discontinuous epitope with more than one cell surface loop of the OMP contributing to its structure. Since the dot blot analysis was unable to detect VR2 from strains NIBSC2147, NIBSC2149, and NIBSC2150, these undefined VRs were cloned into M13 mpl9 and sequenced directly by PCR for inclusion in the panel of reference DNAs. The nucleotide sequences of the cloned VR2 DNAs from strains NIBSC2147 and NIBSC2149 were identical to each other and to VR2 from strain NIBSC2216, indicating that these strains are of the P1.4 subtype (Tables 4 and 5). The serosubtyping of meningococci with monoclonal antibodies against VRs of the class 1 OMP is a valuable epidemiological tool (14, 21). In the case of serogroup A organisms, such serosubtyping can be used as an indicator of clonal subtype (6). The use of DNA-DNA hybridization in the dot blotting procedure to detect nucleotide sequences encoding the antigenically variable domains of this protein provides a simple, reliable, and cheap alternative to the use of monoclonal antibodies. Advantages of this system are that more VRs are detected than by the currently available monoclonal antibodies, new VRs are readily cloned and added to the system, standard DNA samples can be produced and distributed quickly and cheaply, and the membranes can be stripped and reused. Since meningococcal DNA can be PCR amplified directly from cerebrospinal fluid (15), a possible development of this approach is a method for diagnosis and typing in one step, which would make possible (i) the identification and typing of meningococci causing infection in patients undergoing antibiotic treatment and (ii) the investigation of stored serum and cerebrospinal fluid samples. The nucleotide sequences of a number of class 2 and 3 OMP genes encoding various serotyping antigens have been determined (4, 5, 10, 19, 28). These OMPs have a structure similar to that of the class 1 OMP (10, 26), with distinct VRs contributing to the serotype epitopes. The dot blot procedure described here could be extended to include nucleotide sequences from the serotyping antigens, thus permitting both meningococcal serotype and subtype to be determined in a single DNA-DNA hybridization experiment. ACKNOWLEDGMENTS We thank D. M. Jones and A. Fox of the PHLS, Withington Hospital, Manchester; J. T. Poolman of RIVM, Bilthoven, The Netherlands; and M. Achtman, Max-Planck-Institut fur molekulare Genetik, Berlin, Germany, for providing strains and interesting discussions. J. CLIN. MICROBIOL. This work was supported in part with a grant from the British Society for the Study of Infection. J.M. is funded by the National Meningitis Trust. REFERENCES 1. Abdillahi, H., and J. T. Poolman. 1987. Whole-cell ELISA for typing Neissena meningitidis with monoclonal antibodies. FEMS Microbiol. 48:367-371. 2. Achtman, M. 1990. Molecular epidemiology of epidemic bacterial meningitis. Rev. Med. Microbiol. 1:29-38. 3. Branham, S. E. 1953. Serological relationships among meningococci. Bacteriol. Rev. 17:175-188. 4. Butcher, S., M. Sarvas, and K. Runeberg Nyman. 1991. Class-3 porin protein of Neisseria meningitidis: cloning and structure of the gene. Gene 105:125-128. 5. Butcher, S. J., P. J. Omar, M. Sarvas, and K. Runeberg-Nyman. 1991. Sequence comparisons of the class 1 genes from Neisseria meningitidis strains and a folding model of the class 1 protein, p. 193-198. In M. Achtman et al. (ed.), Neisseria 1990. Walter de Gruyter, Berlin. 6. Crowe, B. A., H. Abdillahi, J. T. Poolman, and M. Achtman. 1988. Correlation of serological typing and clonal typing methods for Neisseria meningitidis serogroup A. J. Med. Microbiol. 26:183-187. 7. Embley, T. M. 1991. The linear PCR reaction: a simple and robust method for sequencing amplified rrna genes. Lett. Appl. Microbiol. 13:171-174. 8. Evans, J. R., M. S. Artenstein, and D. M. Hunter. 1968. Prevalence of meningococcal serogroups and description of three new groups. Am. J. Epidemiol. 87:643-646. 9. Feavers, I. M., A. B. Heath, J. A. Bygraves, and M. C. J. Maiden. 1992. Role of horizontal genetical exchange in the antigenic variation of the class 1 outer membrane protein of Neisseria meningitidis. Mol. Microbiol. 6:489-495. 10. Feavers, I. M., J. Suker, A. J. McKenna, A. B. Heath, and M. C. J. Maiden. 1992. Molecular analysis of the serotyping antigens of Neisseria meningitidis. Infect. Immun. 60:3620-3629. 11. Frasch, C. E. 1987. Development of meningococcal serotyping, p. 39-55. In N. A. Vedros (ed.), Evolution of meningococcal disease, 2nd ed. CRC Press, Inc., Boca Raton, Fla. 12. Frasch, C. E. 1989. Vaccines for prevention of meningococcal disease. Clin. Microbiol. Rev. 2(Suppl.):S134-S138. 13. Frasch, C. E., and S. Chapman. 1972. Classification of Neissenia meningitidis group B into distinct serotypes. Infect. Immun. 5:98-102. 14. Frasch, C. E., W. D. Zollinger, and J. T. Poolman. 1985. Serotype antigens of Neisseria meningitidis and a proposed scheme for designation of serotypes. Rev. Infect. Dis. 7:504-510. 15. Kristiansen, B.-E., E. Ask, A. Jenkins, C. Fremer, P. Radstrom, and 0. Skol. 1991. Rapid diagnosis of meningococcal meningitis by polymerase chain reaction. Lancet 337:1568-1569. 16. Maiden, M. C. J., J. Suker, A. J. McKenna, J. A. Bygraves, and I. M. Feavers. 1991. Comparison of the class 1 outer membrane proteins of eight serological reference strains of Neisseria meningitidis. Mol. Microbiol. 5:727-736. 17. Maniatis, T., E. F. Fritsch, and J. Sambroolk 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 18. McGuinness, B., A. K. Barlow, I. N. Clarke, J. E. Farley, A. Anilionis, J. T. Poolman, and J. E. Heckels. 1990. Deduced amino acid sequences of class 1 protein PorA from three strains of Neissenia meningitidis. J. Exp. Med. 171:1871-1882. 19. Murakami, K., E. C. Gotschlich, and M. E. Seiff. 1989. Cloning and characterization of the structural gene for the class 2 protein of Neissena meningitidis. Infect. Immun. 57:2318-2323. 20. Poolman, J. T., C. T. P. Hopman, and H. C. Zanen. 1982. Problems in the definition of meningococcal serotypes. FEMS Microbiol. Lett. 13:339-348. 21. Poolman, J. T., I. Lind, K. Jonsdottir, L. 0. Froholm, D. M. Jones, and H. C. Zanen. 1986. Meningococcal serotypes and serogroup B disease in north-west Europe. Lancet ii:555-557.
VOL. 30, 1992 22. Schwartz, B., P. S. Moore, and C. V. Broome. 1989. Global epidemiology of meningococcal disease. Clin. Microbiol. Rev. 2(Suppl.):S118-S124. 23. Suker, J., A. J. McKenna, J. A. Bygraves, M. C. J. Maiden, and I. M. Feavers. 1991. The use of PCR to study the class 1 outer membrane protein of Neisseria meningitidis, p. 289-294. In M. Achtman, P. Kohl, C. Marchal, G. Morelli, A. Seiler, and B. Theisen (ed.), Neisseria 1990. Walter de Gruyter, Berlin. 24. Tabor, S., and C. C. Richardson. 1987. DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84:4767-4771. 25. Tsai, C.-M., C. E. Frasch, and L. F. Mocca. 1981. Five structural classes of major outer membrane proteins in Neisseria meningitidis. J. Bacteriol. 146:69-78. MENINGOCOCCAL SEROTYPING BY PCR 2841 26. van der Ley, P., J. E. Heckels, M. Vir i, P. Hoogerhout, and J. T. Poolman. 1991. Topology of outer membrane proteins in pathogenic Neisseria species. Infect. Immun. 59:2963-2971. 27. Vedros, N. A. 1987. Development of meningococcal serogroups, p. 33-37. In N. A. Vedros (ed.), Evolution of meningococcal disease, 2nd ed. CRC Press, Inc., Boca Raton, Fla. 28. Wolf, K., and A. Stern. 1991. The class 3 outer membrane protein (PorB) of Neisseria meningitidis: gene sequence and homology to the gonococcal porin PIA. FEMS Microbiol. Lett. 83:179-185. 29. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and puc19 vectors. Gene 33:103-119.