Y-chromosome and mitochondrial DNA polymorphisms in Indian populations

Electrophoresis 1999, 20, 1743±1747 1743 Kumarasamy Thangaraj Gutala V. Ramana Lalji Singh Center for Cellular and Molecular Biology, Hyderabad, India Y-chromosome and mitochondrial DNA polymorphisms in Indian populations Y-chromosome polymorphism using short tandem repeat (STR) markers on 94 normal males belonging to the Brahmin and Kamma caste populations of Andhra Pradesh, India, and Siddis, a migrant population from Africa, inhabiting Hyderabad, India, revealed heterogeneity as indicated by network analysis. We have observed population-specific haplotypes and alleles. Analysis of Y-Alu polymorphism (YAP) in Siddis showed the presence of Alu insertion in 40% of the individuals. However, YAP insertion was not found in Brahmins and Kammas. The dendrogram based on hypervariable region I (HVR I) of the displacement loop (D-loop) sequence of mitochondrial DNA (mtdna) of Siddis showed genetic relationships to African populations. YAP and mtdna analysis of Siddis also confirmed their immigration from Africa. 1 Introduction Polymorphic genetic markers are important tools to study the origin, history and evolution of populations. Short tandem repeats (STR) are widely used markers for polymorphic studies. STR loci consist of simple tandemly repeated nucleotide sequences, which show a high degree of length polymorphisms between individuals due to variation in the number of repeat unit. STRs are widely used in population genetics, molecular evolution, chromosome mapping and linkage analysis, paternity tests and forensic analysis, and medical applications [1±5]. Y-Alu polymorphism (YAP) is another useful marker for polymorphic studies. This polymorphism is known to result from the insertion of an Alu element at the DYS287 locus on the Y-chromosome. The insertion event of the Alu element (YAP+) into the Y-chromosome is known to have occurred very early in human evolution, between 29 000± 34 000 years ago [6]. The noncoding region, called displacement loop (D-loop) of mtdna, which harbors two hypervariable regions (HVR I and HVR II), shows a variation between populations [7]. In recent years mtdna studies found increasing interest in the field of ancient DNA, population studies and forensic case work [8±10]. Y-chromosome and mtdna are transmitted uniparentally, through father and mother, respectively, and do not undergo any recombination. Hence, both are useful to Correspondence: Dr. Lalji Singh, Center for Cellular and Molecular Biology, Uppal Road, Hyderabad 500007, India E-mail: lalji@ccmb.ap.nic.in Fax: +91-40-717-1252 Abbreviations: D-loop, displacement loop; HVR, hypervariable region; YAP, Y-Alu polymorphism Keywords: Y-chromosome / Populations / Short tandem repeat / Y-Alu polymorphism / Mitochondrial DNA EL 3487 trace the paternal and maternal lineages. Using STR markers, haplotypes can be constructed by combining the allelic status of multiple markers which provide adequate information for establishing paternal lineages. A large number of studies have been conducted all over the world on various populations using Y-chromosome markers and the mtdna D-loop to understand their origin, evolution and migration. Indian populations reveal striking diversities in terms of language, marriage practices as well as in their genetic architecture. The social structure of the Indian populations is governed by the hierarchical caste system. In the Hindu caste system, each caste belongs to one of the five main classes/varnas, viz., Brahmins (priests), Kshatriya (warriors), Vyshya (business community), Sudra (rest of the castes) and Pancham (tribes) [11]. In each of the castes/varnas there are well-defined and distinct subgroups (subcastes) which are governed by the gotra systems. The caste system in India has been in vogue for 5000 years [12] which coincides with the time of codification and implementation of the laws of Manu (moral codes) which exert strong influence on the social structure of the Hindu society [13]. In India, there are nearly 5000 well-defined endogamous populations. Several important historical migrations into India saw amalgamation of migrant populations with the local population groups. Major demographic events like migrations, population bottlenecks, and population expansion leave genetic imprints by which gene frequencies are altered. These imprints are passed on to successive generations, thus preserving the population s history within the populations. Hence, it is feasible to study genetic variation in populations of interest to understand their evolutionary history. Nucleic acids WILEY-VCH Verlag GmbH, 69451 Weinheim, 1999 0173-0835/99/0808-1743 $17.50+.50/0

1744 K. Thangaraj, G. V. Ramana and L. Singh Electrophoresis 1999, 20, 1743±1747 In addition to the native populations, there are a few migrant populations inhabiting various parts of India. Siddis are one of the migrant populations from Africa [14]. There are three well-defined groups in Siddis, viz., Christian Siddis, Muslim Siddis and Hindu Siddis. Siddis inhabit Hyderabad, Andhra Pradesh and the North Kanara district of Karnataka. Muslim Siddis are predominantly seen in Hyderabad. Their predecessors worked in the army of the Nizams, who ruled Hyderabad during the 17 th and 18 th century. Earlier, several studies on Indian populations were carried out using blood groups and serum protein markers [15±18] and mtdna [19, 20] to decipher the genetic relationships. In the present study we have attempted to reveal the genetic heterogeneity of native and migrant populations of India, using Y-chromosomespecific markers and the mtdna D-loop sequences. 2 Materials and methods 2.1 Samples Blood samples were collected from healthy and unrelated males belonging to the Brahmin (n=42) and Kamma (n=39) caste populations of Visakapatnam, Andhra Pradesh, India and the Siddi (n=13) population from Hyderabad, India. DNA was isolated from white blood cells using proteinase-k followed by phenol chloroform extraction. 2.2 PCR amplification of Y-chromosome STR markers Six Y-chromosome-specific STR loci such as DYS19, DYS389, DYS390, DYS391, and DYS393 were analyzed. The primers for the locus DYS389 amplify two duplicated loci (DYS389I and DYS389II) and the remaining primers amplify one locus each. All the forward primers were fluorescently labeled (Oswel). Multiplex PCR reactions were carried out in 0.2 ml thin wall tube containing 5 ng of genomic DNA, 10 pm of each primer, 200 mm dntps, 10 mm Tris-HCl (ph 8.3), 50 mm KCl, 1.5 mm MgCl 2, 0.001% gelatin, and 1 U AmpliTaq Gold (Perkin Elmer, Foster City, CA, USA). PCR cycling was carried out in a GeneAmp 9600 thermal cycler (Perkin Elmer); the cycling conditions were 95 o C for 10 min, 29 cycles at 94 o C for 1 min, 55 o C for 30 s, and 72 o C for 2 min. 2.3 Electrophoresis and GeneScan analysis The PCR products were denatured along with size standard (GeneScan 500 ROX) in the presence of formamide and electrophoresed in 4% denaturing polyacrylamide gel using an automated DNA sequencer (ABI Prism 377, Perkin Elmer). Allele sizes were obtained by analyzing the data with GeneScan software. 2.4 YAP analysis The PCR reaction for the detection of the YAP chromosome was carried out according to Hammer and Horai [21]. The amplified samples were size-fractionated in 2% agarose gels. 2.5 Amplification of mtdna D-loop The mitochondrial D-loop was amplified using the primers H408 (5 CTGTTAAAAGTGCATACCGCCA 3 ) and L15996 (5 CTCCACCATTAGCACCCAAACC 3 ). PCR reactions were carried out with 100 ng of DNA in a 25 ml reaction volume with 2 U of Taq. Cycling conditions used were 95 o C for 5 min, 40 cycles at 93 o C for 45 s, 60 o C for 1 min, and 72 o C for 2 min, then 72 o C for 7 min. 2.6 Automated DNA sequencing PCR products were directly sequenced after purification using exonuclease I and shrimp alkaline phosphatase at 37 o C and 80 o C, respectively (15 min each). Sequencing of the purified product (150 ng) was carried out using the Big Dye Terminator ready reaction kit (Perkin Elmer) and 5pM primer. Cycle sequencing conditions were as follows: 30 cycles at 96 o C for 10 s, 50 o C for 5 s, and 60 o C for 4 min. Extended products were purified by alcohol precipitation followed by washing with 70% alcohol. Purified samples were then dissolved in loading dye and electrophoresed in 5% Long Ranger (FMC, Rockland, MG, USA) using ABI Prism 377 automated DNA sequencer. Sequencing analysis and autoassembler software were used for further analysis. 2.7 Sequence analysis The mtdna D-loop sequences of Siddis were aligned with the published sequences from different populations from Africa, Asia, Australia and Europe using CLUSTAL X [22]. Distances between sequences were estimated with DNADIST using the maximum likelihood method. To test the reliability of the tree, 100 bootstrap replicates were run using SEQBOOT. A consensus tree were drawn using the CONSENSE program from the PHYLIP package [23]. 2.8 Statistical analysis The gene counting method was followed for calculating allele frequencies. A Haplotype was constructed using the allele frequencies at all the loci, except DYS389II. The network analysis based on five microsatellite loci (except DYS389II) was carried out employing the principle of parsimony and assuming a single-step mutation process. Haplotype diversity was estimated according to Nei [24].

Electrophoresis 1999, 20, 1743±1747 STR, mtdna and Y-Alu polymorphisms in Indians 1745 3 Results and discussion 3.1 Y-chromosome STR analysis The allele frequencies for six microsatellite markers in Brahmins, Kammas and Siddis are presented in Table 1. Greater diversity in allelic frequencies at all the loci is observed in all populations. We have found population-specific alleles at DYS19 (allele 14), DYS389 II (allele 26) and DYS390 (allele 28) in Kammas, and DYS390 in Brahmins (allele 28) as well as in Siddis (allele 29). Previous studies on the other populations from all over the world have shown that allele 31 of the locus DYS389II is found in only one Mongolian. However, we have observed allele 31 with low frequency (Table 1) in all three populations studied, suggesting that it could be an Asian/Indian specific allele. Of the six loci analyzed, DYS390 showed variations between the three populations (Table 1). The allele frequencies of Siddis in all the loci are identical to African Pygmies [25]. Table 1. Allele frequencies of Y-chromosomal microsatellite markers Locus Allele Brahmins Kammas Siddis (n=42) (n=39) (n=13) DYS19 14 ± 0.0256 ± 15 0.2619 0.3077 0.4170 16 0.6667 0.4616 0.2500 17 0.0476 0.1795 0.3330 18 0.0238 0.0256 ± DYS389I 11 0.0952 0.3077 0.5830 12 0.5714 0.4103 0.4170 13 0.3334 0.2820 ± DYS389II 26 ± 0.0256 ± 27 0.1219 0.2051 0.1670 28 0.3415 0.3590 0.3330 29 0.3171 0.1795 0.2500 30 0.1707 0.1282 0.0830 31 0.0488 0.1026 0.1670 DYS390 21 0.0238 ± ± 22 ± ± 0.0830 23 0.1905 0.0769 0.0830 24 0.2619 0.3591 0.1670 25 0.2143 0.1795 0.3330 26 0.1190 0.2051 0.2500 27 0.1905 0.1538 ± 28 ± 0.0256 ± 29 ± ± 0.0830 DYS391 10 0.0476 ± 0.5000 11 0.8334 0.8462 0.5000 12 0.1190 0.1538 ± DYS393 11 0.0476 0.1795 ± 12 0.2143 0.3590 0.1670 13 0.4762 0.2564 0.5000 14 0.2381 0.1795 0.3330 15 0.0238 0.0256 ± n, Number of male individuals studied Based on the analysis of six microsatellite loci, Y-chromosome haplotypes were constructed for the three populations. The observed haplotypes were 37 in Brahmins, 34 in Kammas, and 11 in Siddis. Interestingly, four haplotypes were shared between the Brahmin and Kamma populations. The observed haplotype diversity is distinctly variable, viz., Brahmins (81.67%), Kammas (96.65%) and Siddis (89.50%). The schematic representation of the network analysis of the three populations is shown in Fig. 1. The network based on four loci of Brahmins and Kammas is widely scattered (Fig. 1A). Network analysis of Siddis, using five loci, showed more diversity (Fig. 1B). A Higher degree of diversity was detected at loci DYS19 and DYS390 in all the populations corroborating the previous studies, which revealed a higher degree of polymorphism for these loci in worldwide populations [25±28]. The presence of the same haplotype in unrelated Brahmins supports the substructuring of Brahmin caste cluster, named after their geographical region or their occupation. The individuals who share the common haplotype belong to different subpopulations but they are from the same lineage. Interestingly, all the subpopulations share the same lineage (gotra) and members belonging to a particular lineage are descendants of rishis of Hindu mythology. Therefore our findings indicate that the subdivision of Brahmins could be a recent phenomenon. 3.2 YAP analysis We have analyzed individuals from Siddis, Brahmins and Kamma populations for the YAP polymorphism. Alu polymorphism was observed in 40% of the Siddis (Fig. 2), whereas Brahmin and Kamma populations did not exhibit the presence of the Alu insertion. Five YAP haplotypes have been identified, of which haplotype 1 and 2 are YAP ± which are known as ancestral state. Haplotype 3±5 are YAP + of which haplotype 3 is known as most ancestral YAP +, lineage [6]. Presence of YAP + and YAP ± haplotypes in Siddis suggests that they possess both ancestral and most ancestral haplotypes. The existence of the Alu insertion in Siddis confirms their African origin. However, absence of the Alu element (YAP ± ) in Siddis could be either due to the African ancestral haplotype or due to the admixture with Indian populations or both. Previous studies have demonstrated that haplotype 1 and 4 are present in Europe and haplotypes 1 and 3 are present in Asian populations. Earlier studies have also shown that absence of Alu insertion was the only haplotype found in New World, South Asian, South East Asian, and Australian samples [29]. Absence of the Alu element in Brahmins and Kammas thus suggests that they represent haplotype 1 or 2. Studies on Alu polymorphism shows heterogeneity within and between populations from different geographical regions [21, 29, 30]. However, a high frequency of

1746 K. Thangaraj, G. V. Ramana and L. Singh Electrophoresis 1999, 20, 1743±1747 A Figure 2. YAP analysis of Siddi individuals showing 455 bp amplification product containing 305 bp Alu insertion (YAP + ). The individuals without Alu insertion (YAP ± ) show the expected size of 150 bp. B Figure 3. Neighbor-joining tree of mtdna sequences from hypervariable region I (HVRI). The tree consists of data from various populations: Siddi, African (AF), American (AM), Australian (AU), Chinese (CH), European (EU), Indian (IN) and Oceanian (OC). Figure 1. (A) Median-joining network analysis of Brahmin and Kamma Y- chromosome microsatellite haplotypes. (B) Median-joining network analysis of Siddi Y-chromosome microsatellite haplotypes. YAP insertion was observed in African populations [29]. Another study also shows that the frequency of YAP insertion is higher in Sub-Sahara African compared to the other populations, suggesting that YAP insertions first occurred on an African Y-chromosome and were then probably exported to the other continents [6].

Electrophoresis 1999, 20, 1743±1747 STR, mtdna and Y-Alu polymorphisms in Indians 1747 3.3 mtdna analysis We have examined the HVR I in the mtdna of Siddi populations. The neighbor-joining tree using mtdna sequences (HVR I) of Siddis along with the sequences of African, Asian, European and Australian populations showed that the Siddis mostly clustered among themselves and with African populations (Fig. 3), thereby corroborating the migratory nature of the population. A few Siddi individuals also clustered with Indian populations, suggesting their probable admixture with this population. 4 Concluding remarks Earlier analysis of protein markers showed that the diversity observed among Indian populations is comparable to that of existing major races of man [31, 32]. The present study on polymorphic analysis of the Y-chromosome using STR markers shows heterogeneity between Brahmin, Kamma and Siddi populations. Allele frequency of Brahmins and Kammas are different from the rest of the world populations; however, allele frequencies of Siddis are comparable with the African pygmies, indicating their probable African origin. In addition, the mtdna and YAP polymorphisms on Siddis also support their African origin. India, geographically centrally located between Europe and Oceania, is relatively easy to reach from Africa across the sea and thus could be a possible choice of migration. Further studies on mtdna variation, Y-chromosome and nuclear DNA polymorphisms in various populations would unambiguously reveal the genetic heterogeneity of Indian populations. We thank Dr. Chris Tyler-Smith, Oxford University, for his help in Network analysis. Received March 22, 1999 5 References [1] Falcone, E., Spadafora, P., De Luca, M., Ruffolo, R., Brancati, C., De Benedictis, G., Hum. Biol. 1995, 67, 689±701. [2] Mitchel, R. J., Hammer, M. F., Curr. Opin. Genet. Dev. 1996, 6, 737±742. [3] Hearne, C. M., Glosh, S., Todd, J. A., Trends Genet. 1992, 8, 288±294. [4] Gill, P., Ivanov, P. L., Kimpton, C., Piercy, R., Benson, N., Tully, G., Evett, I., Hagelberg, E., Sullivan, K., Nature Genet. 1994, 6, 130±135. [5] Thangaraj, K., Gupta, N. J., Chakravarty, B., Singh, L., Lancet 1998, 352, 1121. [6] Hammer, M. F., Nature 1995, 378, 376±378. [7] Stoneking, M., Soodyall, H., Curr. Opin. Genet. Dev. 1996, 6, 731±736. [8] Oota, H., Saitou, N., Matsushita, T., Ueda, S., Am. J. Phys. Anthropol. 1995, 98, 133±145. [9] Cann, R. L., Stoneking, M., Wilson, A. C., Nature 1987, 325, 31±36 [10] Rousselet, F., Mangin, P., Int. J. Legal Med. 1998, 111, 292±298. [11] Malhotra, K. C., Vasulu, T. S., in: Majumder, P. P. (Ed.), Human Population Genetics, Plenum Press, New York 1993, pp. 207±233. [12] Sanghvi, L. D., Anthropologist 1968, 7, 45±53. [13] Basham, A. L., The Wonder that is India, Rupa, Calcutta 1991. [14] Balakrishnan, V., in: Malhotra, K. C., Basu, A. (Eds.), Human Genetics and Adaptation, Plenum Press, New York 1982, pp. 103±145. [15] Char, K. S., Lakshmi, P., Gopalan, K. B., Sastry, J. G., Rao, P. R., Am. J. Phys. Anthropol. 1989, 78, 421±429. [16] Thangaraj, K., Srikumari, C. R., Ramesh, A., Gene Geograph. 1992, 6, 27±30. [17] Ramana, G. V., Naidu, J. M., Murty, J. S., Hum. Biol. 1996, 68, 63±74. [18] Murty, J. S., Muralidhar, B., Goud, J. D., Rao, P. J. M., Babu, R. R., Rao, V. S., Am. J. Phys. Anthropol. 1993, 90, 169±183. [19] Bamshad, M., Raley, A. F., Crawford, M. H., Cann, R. L., Busi, B. R., Naidu, J. M., Jorde, L., Hum. Biol. 1996, 68, 1±28. [20] Mountain, J. L., Hebert, J. M., Bhattacharya, S., Underhill, P. A., Gadgil, M., Cavalli-Sforza, L. L., Am. J. Hum. Genet. 1995, 56, 979±992. [21] Hammer, M. F., Horai, S., Am. J. Hum. Genet. 1995, 56, 951±956. [22] Higgins, D. G., Sharp, P. M., Gene 1988, 73, 237±244. [23] Felsenstein, J., PHYLIP: Phylogeny Inference Package, Version 3.5p. Joseph Felsenstein and the University of Washington, Seattle 1993. [24] Nei, M., Molecular Evolutionary Genetics, Columbia University Press, New York 1987. [25] Kayser, M., Caglia, A., Corach, D., Fretwell, N., Gehrig, C., Grazopso, G., Heidorn, F., Herrmann, S., Herzog, B., Honda, K., Jobling, M., Krawczak, M., Leim, K., Meyer, E., Oesterreich, W., Pandya, A., Parson, W., Piccinini, A., Perez-Lezaun, A., Prinz, M., Szibor, R., Teifel-Greding, J., Weichhold, J., Weichhold, G., de Knijff, P., Roewer, L., Int. J. Legal Med. 1997, 110, 125±133. [26] Gomolka, M., Hundrieser, J., Nürnberg, P., Rower, L., Epplen, J. T., Epplen, C., Hum. Genet. 1994, 93, 592±596. [27] Zejral, T., Dashnyam, B., Pandya, A., Kayser, M., Roewer, L., Santos, F. R., Schiefenhovel, W., Fretwell, N., Jobling, M. A., Harihara, S., Shimizu, K., Semjidmaa, D., Sajantila, A., Salo, P., Crawford, M. H., Ginter, E. K., Evgrafov, O. V., Tyler-Smith, C., Am. J. Hum. Genet. 1997, 60, 1174±1183. [28] Roewer, L., Kayser, M., Dieltjes, P., Nagy, M., Bakker, E., Krawczak, M., de Kniff, P., Hum. Mol. Genet. 1996, 5, 1029±1033. [29] Hammer, M. F., Mol. Biol. Evol. 1994, 11, 749±761. [30] Spurdle, A., Hammer, M. F., Jenkins, T., Am. J. Hum. Genet. 1994, 54, 319±330. [31] Majumder, P. P., Mukherjee, B. N., in: Majumder, P. P. (Ed.), Human Population Genetics, Plenum Press, New York 1993, pp. 255±275. [32] Chandler, W. B., in: Van Sertima, I., Rashidi, R. (Eds.), African Presence in Early Asia, New Brunswick, Canada 1988, pp. 80±105.