DNA Structure and Analysis Chapter 4: Background
Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Central Dogma DNA!RNA!Protein!Trait # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Pop Quiz: What do you know about DNA???
Pop Quiz: What do you know about DNA???
The Structure of DNA Long molecule: Three basic components: Backbone formed by: Nucleotides can be joined together in any order.
The Structure of DNA Nitrogenous base Two Families: Purines Pyrimidines
Chargaff (1952) History of DNA
Rosalind Franklin (1952) History of DNA
History of DNA James Watson & Francis Crick (1953) Model: Discovered hydrogen bonds could form between nitrogenous bases. Principle of base pairing
History of DNA James Watson & Francis Crick (1953) Discovered structure of DNA. Model was double helix. Twisted ladder.
DNA and Chromosomes Eukaryotes: DNA located in nucleus in form of chromosomes.
DNA Length DNA molecules are very LONG. Prokaryote: DNA length = Cell size = DNA:
DNA Length DNA molecules are very LONG. Prokaryote: DNA length = 1.6 mm; Cell size = 1.6 µm. DNA is 1000 X longer than cell. Eukaryotes DNA packed even more tightly.
Chromosome Structure Chromosomes Packed tightly together to form DNA is tightly coiled around proteins
Chromosome Structure Chromatin in interphase = bowl of spaghetti. Chromatin during mitosis = chromosome pairs (X).
DNA Replication Structure Meets Function Structure of DNA explained how it could be copied. Each strand can be used to make the other strand.
DNA Replication Cell must duplicate its DNA before dividing.
DNA Replication Cell must duplicate its DNA before dividing. Each new cell has complete set of DNA molecules. DNA molecules separate into two strands.
DNA Replication Replication Hundreds of sites in genome. Occurs in both directions. Why? DNA replication animation
DNA Replication Replication carried out by enzymes. Each new DNA molecule: Real-time DNA replication
Central Dogma DNA!RNA!Protein!Trait The main flow of protein synthesis in a cell # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
DNA vs RNA DNA double helix explains HOW DNA can be replicated DOES NOT explain how a gene works!
Central Dogma of Biology Two BIG Steps:
DNA vs RNA DNA double helix explains HOW DNA can be replicated DOES NOT explain how a gene works! First step in decoding genes is to copy DNA into RNA.
Structure of RNA Long chain of nucleotides: Structure Meets Function- Three main differences between DNA and RNA:
Structure of RNA vs DNA
Structure of RNA Analogy: RNA is a working copy of a single gene. Main function:
Three main types: Types of RNA Messenger RNA (mrna)
Types of RNA Three main types: messenger RNA (mrna), ribosomal RNA (rrna), and transfer RNA (trna). Ribosomal RNA (rrna)
Types of RNA Three main types: messenger RNA (mrna), ribosomal RNA (rrna), and transfer RNA (trna). Transfer RNA (trna)
Making RNA from DNA: Transcription The process in a cell by which genetic material is copied from ONE strand of DNA to a complementary strand of RNA for protein production. Requires: How is RNA polymerase similar to DNA polymerase?
Making RNA from DNA: Transcription Sense strand Template Antisense strand RNA polymerase
Making RNA from DNA: Transcription First step of gene expression. Steps of transcription: RNA polymerase: Uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA. Can either strand of DNA be used as a template?
Making RNA from DNA: Transcription How does RNA polymerase know where to begin and where to stop? RNA polymerase:
Making RNA from DNA: Transcription How does RNA polymerase know where to begin and where to stop?
Can you work like RNA polymerase and transcribe this DNA? TACTAGACGGTAGCACATATG (DNA)
Can you work like RNA polymerase and transcribe this DNA? TACTAGACGGTAGCACATATG (DNA) AUGACUGCCAUCGUGUAUAC (RNA)
RNA Editing mrna needs to be processed before it reaches its final destination. Gene is broke into 2 parts: Introns Exons
RNA Editing An enzyme: A cap and a tail:
Central Dogma DNA!RNA!Protein!Trait The main flow of protein synthesis in a cell Exceptions to Central Dogma Reverse Transcription # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Restriction Enzymes Formed in bacteria Recognize Cut in either # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Restriction Enzymes Formed in bacteria to resist infection by viral DNA Recognize a particular nucleotide pattern Cut in either a blunt or staggered pattern # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Naming Restriction Enzymes EcoRI E = co = R = I = PstI P = St = I = # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Using Restriction Enzymes Cut source DNA and plasmid DNA with the same enzyme or enzymes Mix the fragments Add DNA ligase to reform sugar phosphate bonds # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Electrophoresis # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
How the Gel Box Works When gel box is running, water is separated into hydrogen and oxygen gas Buffers ensure that the ph remains constant 2 H 2 O 2 e - H 2 _ + H + e - O 2 H 2 O Cathode (reduction): Anode (oxidation): 4 H + + 4 e - 2 H 2 H O 2 + 4 H + + 4 e - 2 2 O HO O HO NH + OH H 3 C O - # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Gel Imaging and Size Estimation FAST Blast DNA Stain SYBR Safe Inverted image # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
Size Estimation Size (bp) Distance (mm) 100,000 23,000 11.0 9,400 13.0 6,500 15.0 4,400 18.0 Size, base pairs 10,000 1,000 B 2,300 23.0 2,000 24.0 100 0 6 12 18A 24 Distance, mm # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com