Analysis of Differential Gene Expression in Cattle Using mrna-seq

Similar documents
Wheat CAP Gene Expression with RNA-Seq

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS

Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit

RNA Sequencing. Next gen insight into transcriptomes , Elio Schijlen

Total RNA isola-on End Repair of double- stranded cdna

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center

Transcriptome analysis

Advanced RNA-Seq course. Introduction. Peter-Bram t Hoen

Multiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms

RNA-Seq data analysis course September 7-9, 2015

Joint RuminOmics/Rumen Microbial Genomics Network Workshop

Single Cell Transcriptomics scrnaseq

Matthew Tinning Australian Genome Research Facility. July 2012

Next Generation Sequencing

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013

1. Introduction Gene regulation Genomics and genome analyses

Wet-lab Considerations for Illumina data analysis

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Applications of short-read

Welcome to the NGS webinar series

Genome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression

Introduction to Microbial Sequencing

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq

Finding Genes with Genomics Technologies

measuring gene expression December 5, 2017

Deep Sequencing technologies

RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)

Genomic & RNA Profiling Core Facility

Statistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies

Library construction for nextgeneration sequencing: Overviews. and challenges

Functional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?

Next-generation sequencing technologies

Supplementary Information for:

Taking Advantage of Long RNA-Seq Reads. Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013

ChIP-seq and RNA-seq

ChIP-seq and RNA-seq. Farhat Habib

Gene Expression Technology

Obtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina

Obtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina

How to deal with your RNA-seq data?

Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA

Computational & Quantitative Biology Lecture 6 RNA Sequencing

Application of NGS (nextgeneration. for studying RNA regulation. Sung Wook Chi. Sungkyunkwan University (SKKU) Samsung Medical Center (SMC)

Experimental Design Microbial Sequencing

Analysis of RNA-seq Data

RNA-Seq analysis workshop

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.

RNAseq Differential Gene Expression Analysis Report

Illumina s Suite of Targeted Resequencing Solutions

Sequence Analysis 2RNA-Seq

CBC Data Therapy. Metatranscriptomics Discussion

RNA-Seq Analysis. Simon Andrews, Laura v

To sequence or not to sequence is not a question anymore. BUT

How it All Works. Sample. Data analysis. Library Prepara>on. Sequencing

An introduction to RNA-Seq. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station

Applications and Sample Preparation for SOLiD Runs

Bioinformatics Advice on Experimental Design

Genome Analyzer. RNA ChIP

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis

Introductory Next Gen Workshop

Introduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012

TECHNICAL NOTE Assay Scheme and Configuration of Chromium Single Cell V(D)J Libraries

Single Cell Genomics

RNA Sequencing: Experimental Planning and Data Analysis. Nadia Atallah September 12, 2018

454 Sample Prep / Workflow at the BioMedical Genomics Center (BMGC) University of Minnesota. Sushmita Singh

Genomic Resources and Gene/QTL Discovery in Livestock

Bioinformatics Monthly Workshop Series. Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory

Application of NGS (next-generation sequencing) for studying RNA regulation

BST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1

Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit

Why QC? Next-Generation Sequencing: Quality Control. Illumina data format. Fastq format:

High throughput DNA Sequencing. An Equal Opportunity University!

G E N OM I C S S E RV I C ES

Supplementary Information

cdna CaptureSeq Reveals unappreciated diversity of the transcriptome

Galaxy Platform For NGS Data Analyses

RNA-Sequencing analysis

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia

Next-Generation Sequencing: Quality Control

Single Cell Genomics

Procedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis)

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

BS 50 Genetics and Genomics Week of Oct 24

The Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience

APPLICATION NOTE. Abstract. Introduction

Hashimshony, Wagner, Sher & Yanai. CEL-Seq: Single cell RNA-Seq by multiplexed linear amplification (Cell Reports).

Chapter 7. DNA Microarrays

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Evaluation of production efficiencies among primiparous suckler cows of diverse genotype at pasture

The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience

Transcription:

Analysis of Differential Gene Expression in Cattle Using mrna-seq

mrna-seq A rough guide for green horns

Animal and Grassland Research and Innovation Centre Animal and Bioscience Research Department Teagasc, Grange, Dunsany, Co. Meath, Ireland

Animal and Bioscience Research Department (Grange site) Department head - Richard Dewhurst Research officers - Kieran Meade, David Kenny, Sinead Waters, Orla Keane, Bernie Early, Chris Creevey, David Lynn Research technologists - Matt McCabe

NGS Technologies Illumina (Solexa) Genome Analyser II (GAII) UCD, Conway. (part-owned by Teagasc) Roche 454 FLX Teagasc Moorepark

Progress 86 polya RNA-seq libraries SR = 12 liver, 48 leukocyte, 21 hypothalamus PE = 5 pooled sheep lymphocyte 14 mi/piwi RNA libraries 16 pooled target enriched DNA libraries Shotgun rumen metagenomic libraries

Important traits Feed efficiency Milk yield Fertility Disease resistance

Negative energy balance Metabolic disorder affecting high yielding dairy cows in the post partum period imbalance between energy intake and energy requirements for lactation and body maintenance.

McCarthy et al. (2010) 12 multiparous cows (parity no. = 4.3-5.2) selected randomly from a pool of 24 Holstein-Friesians with average lactation yield of 6477 354 kg Treatment applied morning after 2 nd or 3 rd milking post-parturition MNEB 6 cows were fed grass silage ad libitum with 8 kg/day of a 21% crude protein dairy concentrate and milked once daily SNEB 6 cows were fed 25 kg/day silage with 4 kg/day concentrate and milked 3 x daily Energy balance was calculated Cows slaughtered on days 6-7 of the first follicular wave after calving RNA extracted from endometrium, spleen, liver

1 2 3 DNA primary-mrna cytoplasm 5 CAP 1 2 3 mature-mrna 1 3 1 2 3 AAAAA AAAAA AAAAA nucleus 1 3 AAAAA 1 2 3 AAAAA

Library preparation UCD protocol using individually purchased reagents from Invitrogen and NEB

1. 10 ug total RNA (RIN ~ 8.0) 6. End repair (Klenow T4 and E. coli polymerase) 2. mrna (Dynal oligo(dt) beads AAAAA 3. Fragment mrna (Zinc) 4. First strand cdna synth (Superscript II) AAAAA TTTTT 5. Second strand cdna synth 7. Add a single A base A 8. Ligate adaptors T A 9. Gel purify 200-300 bp adaptor ligated fragments? 10. PCR amplify (12-18 cycles), quantify on Qubit Fluorometer A A T TTTTTTT AAAAA

Cattle leukocyte SR mrna library preps Aran O Loughlin Yields = 20-30 ng/ul (Qubit)

Single Read Library Adapter Sequence Adapter: 5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3' 3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------- 5' Adapter: 5' -------------------- -------------------- ------------------ (-) pgatcggaagagctcgtatg CCGTCTTCTGCTTG 3' 3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5' PCR Primer: 5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3' 3' -------------------- -------------------- ------------------ (-) -------------------- -------------- 5 PCR Primer: 5' -------------------- -------------------- ------------------ (-) -------------------- -------------- 3' 3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5 Result Library: 5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCTCGTATG CCGTCTTCTGCTTG 3' 3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5 Genomic DNA Sequencing Primer: 5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3' 3' -------------------- -------------------- ------------------ (-) -------------------- -------------- 5'

Paired end mrna seq library prep

Cattle leukocyte mrna library preps Sheep lymphocyte PE mrna library preps

How much coverage? Haploid bovine genome ~2.87 Gb (Elsik et al, 2009) 22,000 protein coding genes 180,000 protein coding exons (~30 Mb) 30 Mb/36 bp reads = 0.83 M reads for 1x coverage Rare transcripts +5 and 3 UTRs? Alternatively spliced isoforms Only 70% reads align to the bovine genome

Ran 12 libraries on 3 flowcells libraries 1-6 = MNEB libraries 7-12 = SNEB Lane Flowcell 1 Flowcell 2 Flowcell 3 1 library 1 (4.5 pm)* library 12 (5.5 pm)* library 2 (5.5 pm)* 2 library 1 (5.0 pm)* library 6 (5.5 pm)* library 3 (5.5 pm) 3 library 5 (5.5 pm)* library 2 (5.5 pm)* library 6 (5.5 pm)* 4 library 5 (6.0 pm)* library 7 (5.5 pm)* library 7 (5.5 pm)* 5 library 10 (4.0 pm)* library 9 (5.5 pm) PhiX 6 PhiX PhiX library 8 (5.5 pm) 7 library 10 (5.5 pm)* library 11 (5.5 pm)* library 11 (5.5 pm)* 8 library 10 (6.5 pm)* library 4 (5.5 pm) library 12 (5.5 pm)*

Bowtie Alignment (to BCM4) TopHat Splice junction mapper Cufflinks Assembles aligned reads into transcripts Computes expression values

Cufflinks

1 2 3

Short SR 1 2 3

Short SR 1 2 3

Short SR 1 2 3

Alternatively spliced isoforms 1 3 1 2 3

Alternative splicing predictions generated by Tophat Displayed on Integrative Genomics Viewer

Summary data (average for 21 lanes) Total number of reads 13,664,739 Reads with only one alignment and no duplicates 8,539,432 (62%) Number of islands detected 212,491 Number of exon/exon junctions detected 19,606

# of unique splice junctions detected for all 21 lanes Total 110365 Alternative splicing # of splice junctions for the exon 99801 1 9077 2 1185 3 248 4 39 5 8 6 4 7 3 8

Short PE sequencing 1 2 3

Long PE sequencing 1 2 3

COST Sequencing kit = 1K SR cluster gen kit = 2K PE cluster gen kit = 4K Short SR = 1 seq kit + 1 SR cluster kit = 3K Long SR = 2 seq kits + 1 SR cluster kit = 4K Short PE = 2 seq kits + 1 PE cluster kit = 6K Long PE = 4 seq kits + 1 PE cluster kit = 8K

Microarray vs. mrnaseq RNAseq = 16,720 genes Microarray analysis = 12,679 genes RNAseq + microarray = 10,950 genes RNAseq only = 5,770 genes Microarray analysis only = 1,729 genes

Analysis of significantly differentially expressed genes in MNEB and SNEB animals

Analysis of significantly differentially expressed genes in MNEB and SNEB animals Expression values FPKM calculated using Cufflinks (Fragments Per Kilobase of exon per Million fragments mapped)

FPKM values

PCA of FPKM values in all lanes in mild (M) and severe (S) NEB animals

Analysis of significantly differentially expressed genes in MNEB and SNEB animals 348 SDE genes (<FDR 0.05) 438 SDE genes (<FDR 0.1)

Analysis of significantly differentially expressed genes in MNEB and SNEB animals 348 SDE genes (<FDR 0.05) 438 SDE genes (<FDR 0.1) SDE of 350 of these genes was also shown in the microarray

Correlation of 350 SDGEs in Microarray and mrnaseq

Lane effect Used Edge R to compare FPKM values of libraries run on 2 lanes Libraries 2,5,6,7,9,10,11,12 (1st lane) vs. Libraries 2,5,6,7,9,10,11,12 (2nd lane) found 40 differentially expressed genes!!!

Lane effect

Pathway analysis IPA analysis of microarray and RNAseq data show same top networks affected by SNEB Innate DB analysis GOseq

What next FRT-Seq??

Acknowledgements Chris Creevey, David Lynn - Teagasc Paul Cormican -Trinity Amanda Lohan, Alison Murphy - UCD Elaine Kenny -Trinity Sinead Waters, Sean McArthy, Dermot Morris -Teagasc

2024 © businessdocbox.com Privacy Policy | Terms of Service | Feedback