History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists i named Boyer and Cohen in 1973. Recombinant DNA Formed when two genes from two different sources - often different species are combined in vitro into the same molecule This process is called genetic engineering g Lead to a new field called biotechnology, the manipulation of organisms or their components to make useful products Fig. 1.2 Many scientific disciplines contribute to molecular biotechnology, which generates a wide range of commercial products DNA cloning gene cloning - prepare multiple identical copies of gene-sized pieces of DNA. Generation of DNA fragment Joining into a vector or carrier molecule Introduction into host cell to amplification Selection of required sequences ١
Genes can be cloned into recombinant DNA vectors Generation of DNA fragment Mechanical shearing Restriction enzymatic digestion Joining into a vector Blunt end ligation Sticky end ligation Introduction into host cell Transformation with recombinant plasmid Five steps: Isolation of vector and gene Insert gene into vector Transform bacteria with vector Plate bacteria under selection Identify clones carrying vector Direct chemical synthesis PCR RT-PCR Homopolymer tailing Use of linker Ligase independent cloning Transfection with recombinant phage Packaging DNA in vitro Generation of DNA fragment Enzymatic digestion of purified DNA PCR RT-PCR Restriction enzymes are used to make recombinant DNA Cut DNA at specific DNA sequences symmetrical series of four to eight bases Sticky or blunt ends Restriction fragments-specific for each DNA Origin bacteria How do they protect their own DNA? Combined by DNA ligase Methods of Introducing Foreign DNA Transformation Electroporation Conjugation How can you identify which clones carry the vector? 1) Nucleic acid hybridization 2) Isolation of plasmid DNA from individual clones and restriction mapping PCR ٢
PCR: History PCR Invention: 1987 Kary Mullis PCR is essentially DNA replication in a tube. Series of repetitive steps enabling amplification of target DNA from a complex mixture of DNA The major advantages of PCR Speed and ease of use 30 cycles each taking 3-5 mins Sensitivity Can amplify from a single cell, great care must be taken to avoid contamination Robustness Will even work on degraded DNA or fixed DNA Disadvantages of PCR Need for Target DNA sequence information To construct primers you need to know your target Short size limit for product There is an upper limit to the size of DNA synthesized by PCR Infidelity of replication Because the PCR polymerases are heat stable they ten not to have the 3 ->5 exonuclease activity Target dntp s Buffer Primers DNA Taq polymerase Basics Denature- 92 0 C-95 0 C (94 0 C) Anneal-50 0 C-72 0 C Aim for 5 0 C below calculated Tm (52 0 C-58 0 C generally best) Extension -68 0 C-80 0 C (72 0 C) highest efficiency 70 0 C-80 0 C Plasmid cdna (RT-PCR) Genomic DNA P C P C Plasmid Genomic Template Purified (P) Crude Lysate (C) 40ng 10ng 1ng ٣
dntps Mixture of datp, dctp, dgtp, dttp or dutp Purity- chemical or enzymatic synthesis Stability- concentration Li or Na salt form Buffer All 10x Buffers are not the same Salt 10-50 mm Tris ph 8.3 Monovalent cation 100-150 150 mm KCl or NaCl Divalent cation Mg2+, Mn2+ Additives 1.5uM or > MgCl 2+ Detergent, Glycerol, Gelatin Modifications: Mg ph Ionic strength Additives Buffer Systems Mg2+ Q-solution-Betaine DMSO BSA Glycerol Gelatin PEG GC-melt Formamide Detergents Buffer Additives Q D B G P Q/D F D Ionic strength Primers Pair complementary to opposite strands 5 3 sense primer 3 5 anti-sense primer Features 18-26 nucleotides Match Tm of primers Equal mix GC to AT bases Tm o C= 2(A/T) + 4(G/C) 3 Stability GG or GC clamps Additional Considerations Secondary structure- avoid hairpins, self-dimers, cross- homology Avoid di-nucleotide repeats that occur consecutively- ATATATAT Avoid long runs of single bases- ACGGGGGGAT Avoid cross-homology homology- BLAST Test ۴
Primer Variation Example Forward primers Primer 1: GAGGGCAGATTCGGGAATG Primer 2: TCGGGAGAGGCCCTTCCC Primer 3: CAGTTTCCCGGGTTCGGC PCR 1 st Round vary primer pairs Sets A-F A= Primer 1F Primer 1R B= Primer 2F Primer 1R C= Primer 3F Primer 1R D= Primer 1F Primer 2R E= Primer 2F Primer 2R F= Primer 3F Primer 2R Tm=60 0 c Tm=62 0 c Tm=60 0 c DNA Taq Polymerases Considerations: Aim of experiment Thermal stability Processivity Fidelity Reverse primers Primer 1: AGCCTAATCAAGTCACTATCAAG Primer 2: GCAAGTGAGAAAATGGGGAG Tm=62 0 C Tm=60 0 C DNA Taq Polymerases Standard polymerase Standard polymerase with loading dye Hot Start polymerase Polymerase blends or cocktails works for most applications aids in higher through-put inhibits non-specific primer extension combine polymerases for fidelity with speed Fidelity PCR product sequence Taq blend Standard Taq Hot Start Taq PCR product T/A cloned Individual isolates sequenced PCR Cycling Modified PCR Methods Hot Start PCR Manual Hot Start Physical Barrier Modified dt Taq DNA polymerase Oligo Inhibitors Modified dntp s Semi-Nested or Nested PCR Touch down PCR ۵
Semi-Nested or Nested-PCR Specificity ----------------------- -------------------- Sensitivity Additional PCR Methods Allele-specific PCR Assembly PCR (PCA) Breakpoint PCR Intersequence-specific specific PCR (ISSR) Inverse-PCR (IPCR or RE-PCR) Ligation Mediated PCR (LM-PCR) Long distance PCR Multiplex-PCR Methylation Specific PCR Mini-primer PCR Quantitative PCR or Real-time PCR Reverse Transcriptase PCR (RT-PCR) Quality of RNA Reverse Transcriptase-QC oligo dt random hexamers gene specific primers RT-PCR Multiplex-PCR Increase throughput Increase data with limited material 2 3 4 5 6 7 8 1 9 Exon 7 and 8 Exon 9 Exon 3 Exon 5 Exon 1 Exon 2 Exon 6 Exon 4 Long-PCR Analyze large area in single reaction Tool to analyze inserts and breakpoints 14kb 3kb Breakpoint-PCR Isolate low frequency event 20kb 1.6kb ۶
Inverse-PCR and RE-Inverse PCR Isolate unknown flanking region Digest with restriction enzyme Ligate with T4 DNA ligase Restriction fragment length polymorphism Allele specific PCR Genomic Walking TaqMan assay Allele specific PCR using the 5 to 3 exo activity and a third primer with a Fluor and dquencher. Real-Time PCR or Q-PCR Increased Sensitivity Increased Specificity Increased Throughput ٧
Designing of primers PCR reaction Identification of restriction map: http://www.firstmarket.com/cutter/cut2.html Primer Design http://frodo.wi.mit.edu/primer3/ Evaluation of primers specifity http://www.ncbi.nlm.nih.gov/tools/primerblast/index.cgi?link_loc=blasthome Introducing of restriction sites PCR cycle Cloning of PCR products transformation Plasmid digestion PCR product digestion Measurement of molar concentration of DNA http://www.basic.northwestern.edu/biotools/olig th t /bi t / li ocalc.html Ligation transformation Heat shock electroporation ٨
Preparing medium Antibiotic selection Liquid culture Plasmid extraction ti Plasmid identity confirmation Sequencing subcloning Extraction of plasmid ٩