Do engineered ips and ES cells have similar molecular signatures?

Similar documents
What we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?

Introduction to Bioinformatics and Gene Expression Technology

NGS Approaches to Epigenomics

Go to Bottom Left click WashU Epigenome Browser. Click

Supplemental Figure 1.

LIFE. How-to 2 Cloning and Epigenetics. More great student questions of the day. 1. Reproductive vs therapeutic cloning

Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute

EUKARYOTIC GENE CONTROL

Introduction to Microarray Analysis

Edexcel (B) Biology A-level

Bioinformatics of Transcriptional Regulation

Introduction to human genomics and genome informatics

Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017

Advanced Cell Biology. Lecture 17

2/19/13. Contents. Applications of HMMs in Epigenomics

Applications of HMMs in Epigenomics

Control of Eukaryotic Genes. AP Biology

Chapter 20: Biotechnology

Selected Techniques Part I

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to Bioinformatics and Gene Expression Technologies

Introduction to BIOINFORMATICS

Control of Eukaryotic Genes. AP Biology

Microarrays and Stem Cells

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.

3.1.4 DNA Microarray Technology

Introduction to the UCSC genome browser

Lecture 21: Epigenetics Nurture or Nature? Chromatin DNA methylation Histone Code Twin study X-chromosome inactivation Environemnt and epigenetics

Epigenetics. Medical studies in English, Lecture # 12,

LABORATORY FUNDAMENTALS IN BIOLOGICAL ENGINEERING. Leona Samson. MODULE 2 EXPRESSION ENGINEERING Lecture # 3.

GENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/

7. For What Molecule Do Genes Contain The

Lecture 9. Eukaryotic gene regulation: DNA METHYLATION

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes

2/10/17. Contents. Applications of HMMs in Epigenomics

Direct Reprogramming of Fibroblasts into Cardiomyocytes

Unit II Problem 3 Genetics: Summary of Basic Concepts in Molecular Biology

SUPPLEMENTARY INFORMATION

Genomes: What we know and what we don t know

Chapter 18. Regulation of Gene Expression

Unit 7. Genetic Regulation, Development, and Biotechnology. AP Biology

H3K36me3 polyclonal antibody

MCDB 1041 Class 21 Splicing and Gene Expression

Wednesday, November 22, 17. Exons and Introns

Complete draft sequence 2001

Division Ave. High School AP Biology

Bio5488 Practice Midterm (2018) 1. Next-gen sequencing

Y1 Biology 131 Syllabus - Academic Year

ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System

Exam 2 BIO200, Winter 2012

Chapter 19 Genetic Regulation of the Eukaryotic Genome. A. Bergeron AP Biology PCHS

Control of Eukaryotic Genes

Multi-omics in biology: integration of omics techniques

Controlling DNA. Ethical guidelines for the use of DNA technology. Module Type: Discussion, literature review, and debate

Galaxy Platform For NGS Data Analyses

Control of Eukaryotic Genes. AP Biology

DNA:CHROMATIN INTERACTIONS

Chemistry 106: Drugs in Society Lecture 17: Where Do Macromolecular Targets Come From? 5/07/18

Motivation From Protein to Gene

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

DNA METHYLATION NH 2 H 3. Solutions using bisulfite conversion and immunocapture Ideal for NGS, Sanger sequencing, Pyrosequencing, and qpcr

Chapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".

Exome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.

GATCGTGCACGATCTCGGCAATTCGGGATGCCGGCTCGTCACCGGTCGCT

ANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134)

Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko

a previous report, Lee and colleagues showed that Oct4 and Sox2 bind to DXPas34 and Xite

Gene Expression in Stem Cells Featured scientist: Adam Heck from Colorado State University

Control of Eukaryotic Gene Expression (Learning Objectives)

COURSE OUTLINE Biology 103 Molecular Biology and Genetics

Genome Sequence Assembly

COMPUTER RESOURCES II:

Genes - DNA - Chromosome. Chutima Talabnin Ph.D. School of Biochemistry,Institute of Science, Suranaree University of Technology

DNA is normally found in pairs, held together by hydrogen bonds between the bases

Why DNA Isn t Your Destiny

Wilkins Franklin s photo below proved model on left to be correct for DNA

Advanced Cell Biology. Lecture 18

Modelling and Analysis in Bioinformatics: Gene regulation and experimental functional genomics

What is Epigenetics? Watch the video

Chapter 1. from genomics to proteomics Ⅱ

Topics in Molecular Biology ( ) 3 rd Lecture Hall, Room 504 Thursday 1pm-2:50pm

Analysis of Microarray Data

Hands-On Four Investigating Inherited Diseases

Videos. Lesson Overview. Fermentation

DNA and RNA. Chapter 12

Chapter 5 DNA and Chromosomes

Conference Feedback Report

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics

Bioinformatics for Biologists

BIOINF/BENG/BIMM/CHEM/CSE 184: Computational Molecular Biology. Lecture 2: Microarray analysis

MODULE TSS1: TRANSCRIPTION START SITES INTRODUCTION (BASIC)

MODULE 5: TRANSLATION

AP Biology Gene Expression/Biotechnology REVIEW

Investigating Inherited Diseases

AQA Biology A-level Topic 8: The control of gene expression

Tissue Acetyl-Histone H4 ChIP Kit

The Plant Cell, March 2013, American Society of Plant Biologists. All rights reserved.

Protocol Using the Reprogramming Ecotropic Retrovirus Set: Mouse OSKM to Reprogram MEFs into ips Cells

ChIP-seq/Functional Genomics/Epigenomics. CBSU/3CPG/CVG Next-Gen Sequencing Workshop. Josh Waterfall. March 31, 2010

Permutation Clustering of the DNA Sequence Facilitates Understanding of the Nonlinearly Organized Genome

Transcription:

Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series for High School Students 1

What we ll do today Research questions in stem cell biology Measuring gene expression levels Compare gene levels in fibroblasts, ES, and ips cells Structure and function of histones Assaying histone modifications Compare histone modifications in fibroblasts, ES, and ips cells 2

Types of stem cells What is a stem cell, anyway? ability to self-renew (and produce more stem cells) ability to differentiate into different/any cell types Embryonic stem (ES) cells www.stemcellresearch.org Adult stem cells Induced pluripotent stem (ips) cells 3

What genes are special in stem cells? Given that stem cells can self-renew and differentiate into many or all types of cells, What genes are responsible for this behavior? Canthesegenes teach us about Human development? Cell division? Differentiation? Regenerating damaged tissue? stemcells.nih.gov 4

Bioinformatics Bioinformatics = the application of computational methods to the field of molecular biology Also called Computational Biology More and more biology experiments include lots and lots of measurements so many biologists need to Use computers to analyze data Use statistics to help determine the confidence of any conclusions 5

Measuring levels of each gene DNA microarrays Glass slides with up to millions of spots of short DNA sequences When a solution of DNA (often converted from RNA) is added, d genes stick to spots which h are found in their sequence GGACTGAGTCACGATCGATACGTGACGCAGTAATGCATTTAAATGCATTACTGCGTCACGTATCGATCGTGACTCAGTCC High-throughput h t sequencing Convert RNA to DNA and break into small pieces Read beginning of DNA sequence 6

To do open your clustered expression matrix 1. Open the program Java Treeview by double- clicking on it 2. Open your clustered expression matrix File => Open Select the cdt file (containing relative mrna levels) on the Desktop in HS_Program_2012/Expression/ 3. [Click on Dismiss if necessary] 4. With your mouse, select any interesting region of the colored panel at left. 5. What are you looking at? 7

To do examine your heatmap By convention: Red = Higher than the average for this gene Green = Lower than the average for this gene 8

Genes modified to make ips cells To turn fibroblasts into ips cells, several stem cell genes were turned on, like Pou5f1, Sox2, Nanog, and Myc Compared to fibroblasts, do the levels of these genes actually change? To answer this question, go to Analysis > Find Genes Pou5f1 Sox2 (multiple probes) Nanog Myc 9

Epigenetics The study of heritable changes that involve changes other than DNA sequence Common epigenetic changes include DNA methylation: a methyl ygroup is added to a nucleotide Example: Cytosine => 5-methylcytosine (which may turn off nearby genes) Histone modifications: Amino acids in proteins that t make up nucleosomes can be chemically modified 10

A nucleosome is made of 2 copies of 4 different histone proteins K = lysine (amino acid) Some histone modifications (methylation, acetylation) influence gene transcription of nearby genes Cui L, Miao J Eukaryotic Cell 2010;9:1138-1149 11

Identifying histone modifications Mix DNA from your cells with a specific histone antibody Let antibody stick to the specific modified histone Get DNA that wraps around this histone Sequence DNA Map DNA to genome Szalkowski AM and Schmid CD (2010) 12

Significance of histone marks Me Me Me Me Gene is Gene is Gene is active NOT active NOT active but ready for activity 13

Finding locations of histone modifications with a genome browser 14

Loading the histone modification data into the genome browser Open IGV (the Integrative Genomics Viewer) Load the short DNA reads from the histone modification analysis by Go to File >> Open Session Select a file on you Desktop: HS_Program_2012/IGVsession/igv_session.xml Note that the names on the left indicate the histone modification (H3K4me3 or H3K27me3) and cell type 15

Examining the epigenetics of stem cell genes Where IGV shows the chromosome location (in the white box), type one at a time (and then click "Go") Sox2 Nanog Myc Pou5f1 (chr6:31,130,000 130 000-31,140,000) 140 000) For each of these, do you see a bunch of H3K4me3 and/or H3K27me3 tags (reads)? In what cell types? What does this tell you? 16

Other exercises 17

Summary Gene expression profiles can be used to examine gene activity Microarrays High-throughput sequencing Many genes are expressed at a different level in stem cells compared to differentiated cells Almost all genes are turned on in a similar level in ES and ips cells Histone-specific antibodies can identify which histone modifications occur throughout the genome. Many epigenetic marks are different between stem cells and differentiated cells Most histone marks appear in the same places in the genomes of ES and ips cells So are engineered ips cells and embryonic stem cells the same? 18