As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed variable number of tandem repeats which are highly polymorphic within certain regions of each individual. This technique had a very high power of discrimination per loci however it required a large amount of high quality DNA sample. As the polymerase chain reaction (PCR) was developed a new technique known as Short Tandem Repeat (STR) became the new standard for DNA analysis. PCR/STR has allowed the use or small and degraded DNA samples which has been a major breakthrough especially within the field of Forensics. Even though PCR/STR is the most common technique used today Y STR and mitochondrial DNA typing are new technologies that can often prove to be very valuable when dealing with certain type of cases. The multiplexing and automation of today s systems have a reduced the time, cost and invariably cemented its application in forensic science. Basic Steps of the DNA process
Restriction Fragment Length Polymorphism (RFLP): RFLP requires a restriction enzyme which cuts the DNA at a specific location. These fragments are then separated into their different sizes using an electrophoresis agarose gel. The smaller fragments travel much faster through the gel and hence appear further along the gel strip. The fragments are then fixed to a nylon membrane which is then labeled typically with a P 32 probe. This probe binds to only specific regions on the fragments. It must then be washed and exposed to X ray and photographic film. The result is a barcode like image which could be compared to known and size standards. Summary of the steps involve in RFLP Reference: http://www.ntu.edu.sg/home2004/wong0172/rflp.jpg
Polymerase Chain Reaction (PCR): PCR or Polymerase Chain Reaction was discovered by Kary Mullis in 1985 and is a way to copy a DNA molecule. This process is an enzyme type reaction which revolves around the conditions of the enzyme. Three stages to PCR 1. Denaturation this occurs with an increase of temperature where the weak hydrogen bonds are broken and the double strand DNA separates into two single strands. Temperature may vary according to enzyme and desired result (usually above 90 degrees) 2. Annealing Here the primers bind to the separated complement strands due to lowering of temperature to allow the DNA to recombine. The primers are added in excess to ensure that the primer binds and not the original DNA( 54 degrees) 3. Extension The polymerase add dntp s in the 5 to 3 direction. The primers are extended by addition of complementary bases (A,T, C, G) read from the 3 to 5 direction.(72 degrees). This process is repeated about 30 times which produce billions of copies of DNA which can then be used for STR analysis. For this reaction to take place you must have the right master mix which include; template DNA,dNTP s, primers and DNA polymerase(taq). There are six different components that are required for a PCR; 1. DNA Template this must be clean DNA that is no inhibitors. This may be cleaned with a gene clean silica matrix. Microcon 100 can also be used to help clean. May want to dilute sample if too concentrated to dilute inhibitors however may lose rare copy genes. 2. Primers usually 15 35 bp should be universal so that it binds to the same sites on the DNA. They should also have a similar %G C as the target DNA. The concentration should be optimized for best results. 3. DNA polymerase this is the enzyme that drives the reaction. Must be chosen carefully depending on what you want to achieve. Beware of inhibitors which might degrade the proteases, denature them and block the active sites. 4. Magnesium This is required to activate the polymerase and must be optimized to the specific reaction. It is often affected by the template concentration, chelating agents(edta), dntp s, proteins and heavy metals. The magnesium should not be added in excess as it would reduce the fidelity of the enzyme. 5. Buffer mix & dntp s The buffer is specific to the enzyme that is being used and is optimized by adding magnesium. The dntp s are required for the base addition and are often present in equal amounts. It may be varied to reduce base stacking interactions, hydrogen bonding and the strand separation temperature
6. PCR Enhancing Reagents these compounds are added to the reaction to help increase the stability, lower temperatures and help make the process more selective. Common additives are DMSO, BSA, T4 gene protein32, Glycerol and Acetamide. Diagram Showing the steps involve in a PCR reaction Reference: http://www.ocf.berkeley.edu/~edy/pcr.jpg Link to http://teachers.henrico.k12.va.us/deeprun/southworth_s/i_protein_synthesis/pcr%20virtual%20lab/p CRVirtualLab.html
Short Tandem Repeat (STR): Short Tandem Repeat is the term used to describe when a sequence of DNA within a specific region is repeated numerous times. These are often referred to as microsatellites. These repeat units are typically a few base pairs long and directly follow each other. In field of forensics the use of tetra nucleotide repeats are mostly used as it has significant advantages. Most of these repeat units are part of the noncoding or junk DNA and is very highly polymorphic. STR works by counting the number of times each repeat occurs within that specific area on the chromosome or loci. Example TTCCATTTGGAATGAATGAATGAATGAATGAATGATGAGTTTCAA We can see that the sequence ATGA is repeated six times within this particular location. These are what we refer to as short tandem repeats. Today with the ability to perform PCR reactions coupled with STR s forensic scientist are able to use very small or degraded DNA samples to obtain a full DNA or STR profile. Technology has also allowed for the use of different STR loci to be tested in the same reaction. This is known as multiplex STR analysis and can look up to 19 different loci at the same time. This provides a very high power of discrimination when looking at the probably of two same DNA profiles. The instruments today are mostly automated and most forensic laboratories couple the PCR STR to a capillary electrophoresis device to obtain an electropherogram or DNA picture. This is an electropherogram or PCR STR profile for an unknown sample. It could then be compared to known sample for a possible match. http://www1.qiagen.com/literature/qiagennews/weeklyarticle/may03/e16/images/fig2.gif
Y STR : This technique looks at short tandem repeats located on only the Y chromosome which means that it can only be detected in males. It is inherited from your father which means that it is not as individual as normal STR analysis. Different members of your paternal family may have the same profile. So why use such analysis? This type of analysis can be most beneficial in cases of multiple male donors and mixtures (for example gang rapes) where normal STR analysis have difficulty in separating the multiple male in the sample mixture. Mitochondrial DNA (mtdna) Mitochondrial DNA is the female version of Y STR however mtdna occurs in a much higher concentration which means that the possibility of obtaining a profile is much higher. However this is not nucleic DNA and is inherited maternally. This type of analysis is often done on samples of hair and highly degraded samples, however is not very discriminative and may only give the maternal side of a profile. Example of how mtdna is inherited within a family tree http://www.jpac.pacom.mil/cil/images/dna_chart.gif