Figure S1. gfp tola and pal mcherry can complement deletion mutants of tola and pal respectively. (A)When strain LS4522 was grown in the presence of xylose, inducing expression of gfp-tola, localization of the GFP-TolA protein was similar to that of wild-type. The viability of the strain demonstrates that the GFP-TolA fusion protein alone complemented the TolA depletion phenotype. The Pal-mCherry fusion also fully complemented the Pal depletion phenotype. (B) The GFP-TolA fusion proteins were characterized by Western blot analysis using an anti-gfp antibody. There was no significant clipping of the fusion releases observed. (C) The Pal-mCherry fusion proteins were characterized by Western blot analysis using an anti-pal antibody. There is a small amount of degradation that results in clipping of the Pal-mCherry, while full-length Pal-mCherry is the major form.
Figure S2. Phenotype of Pal depletion strain. (A) A schematic diagram of the construction of Pal depletion strain, LS4524. An in frame deletion of pal was constructed by deleting base pairs 37-531, out of a total of 567 bp of coding sequence, while the full-length pal gene was integrated at the chromosomal xylx locus. (B) CFU for strain LS4524 grown in PYEX, washed and then incubated in the presence of either PYEG or PYEX. Cell viability decreased after 9 h of growth in PYEG (indicated by arrows). LS4524 was grown in PYEX, washed and then suspended in PYEG (t = 0 h). Protein levels were measured by western blot analysis of samples taken at the indicated times during the course of Pal depletion.
Figure S3. Phenotype of TolA and TolB depletion strains. (A) A schematic diagram of the construction of TolA depletion strain, LS4525. An in frame deletion of tola was constructed by deleting base pairs 37-777, out of a total of 813 bp of coding sequence, while the full-length tola gene was integrated at the chromosomal xylx locus. A tolb depletion strain was constructed by incorporating a truncated version of tolb at the native chromosomal site and a second, full-length copy under control of the xylose inducible promoter, creating the strain LS4526. (B) CFU for strain LS4525 and LS4526 grown in PYEX, washed and then incubated in the presence of either PYEX or PYEG. Cell viability decreased after 12 h of growth in PYEG (indicated by arrow). (C) To visualize cell morphology in cells depleted of TolA, as compared to cells containing TolA, strain LS4443 was grown in PYEX to induce tola expression. Cells were then washed and grown in PYEG for 12 h to deplete TolA. When strain LS4525 was grown in PYEG for 12 h, cells exhibited a late-stage cell division defect and polar blebs (indicated by arrows). (D) To visualize cell morphology in cells depleted of TolB, strain LS4526 was grown in PYEX, as described for LS4525. When strain LS4526 was grown in PYEG for 12 h, cells exhibited cell division and membrane integrity phenotypes (indicated by arrows).
Table S1: Strains and plasmids Strain or synchronizable derivative of Caulobacter crescentus CB15 (Evinger & Agabian, 1977) LS4517 xylx::pxylx -tolq-yfp Electroporation of pyc103 into LS4518 xylx::pxylx -gfp-tolr Electroporation of pyc104 into LS4519 xylx::pxylx -gfp-tola Electroporation of pyc105 into LS4520 xylx::pxylx -mcherry-tolb Electroporation of pyc106 into LS4521 xylx::pxylx -pal-mcherry Electroporation of pyc107 into LS4522 tola xylx::pxylx-gfp-tola LS4525X Φ (LS4519) LS4523 pal xylx::pxylx-pal-mcherry LS4524X Φ (LS4521) EG 052 xylx::pxylx-ftsz venus (Goley, unpublished ) EG 055 xylx::pxylx venus-ftsa (Goley, unpublished) EG 051 xylx::pxylx venus ftsi (Goley, unpublished ) LS3702 ftsz xylx::pxylx-ftsz (Wang et al., 2001) EG 083 ftsa xylx::pxylx-ftsa (Goley, unpublished) LS4524 pal xylx::pxylx-pal Constructed using pyc102 and pyc200 LS4525 tola xylx::pxylx-tola Constructed using pyc101 and pyc201 LS4526 tolb tolb::pxylx-tolb Electroporation of pyc103 into LS4527 tipn::tipn-gfp (Huitema et al., 2006) LS3785 plec::plec-gfp (Viollier et al., 2002) LS4199 divj::divj-yfp (Matroule et al., 2004)
Strain or GB175 vana::pvan-popz-yfp (Bowman et al., 2008) LS4528 tipn::tipn-gfp pal xylx::pxylx-pal LS4524X Φ (LS4527) LS4529 tipn::tipn-gfp tola xylx::pxylx-tola LS4525X Φ (LS4527) LS4530 plec::plec-gfp pal xylx::pxylx-pal LS4524X Φ (LS3785) LS4531 plec::plec-gfp tola xylx::pxylx-tola LS4525X Φ (LS3785) LS4532 divj::divj-yfp pal xylx::pxylx-pal LS4524X Φ (LS4199) LS4533 divj::divj-yfp tola xylx::pxylx-tola LS4525X Φ (LS4199) LS4534 pal PxylX-pal vana::pvan-popz-yfp LS4523X Φ (GB175) LS4535 tola PxylX-tolA vana::pvan-popz-yfp LS4524X Φ (GB175) LS4536 tipn::tipn-gfp tola xylx::pxylx-tola-m2 LS4537 X Φ (LS4527) LS4537 tola xylx::pxylx-tola-m2 LS4525X Φ (LS4545) LS4538 xylx::pxylx-tipn-m2 Electroporation of pyc119 into LS4539 tola xylx:: PxylX-tolA vana::pvan-pal-mcherry Electroporation of pyc113 into LS4525 LS4540 tola xylx::pxylx-tola ppvan-tolq-yfp Electroporation of pyc110 into LS4525 LS4541 tola xylx::pxylx-tola ppvan-yfp-tolr Electroporation of into pyc111 LS4525 LS4542 pal xylx::pxylx-pal ppvan-tolq-yfp Electroporation of pyc110into LS4524 LS4543 pal xylx::pxylx-pal ppvan-yfp-tolr Electroporation of pyc111into LS4524 LS4544 pal xylx::pxylx-pal ppvan-yfp-tola Electroporation of pyc112into LS4524 LS4545 xylx::pxylx-tola-m2 Electroporation of pyc114 into LS4524 LS4546 ftsz xylx::pxylx-ftsz ppvan-yfp-tola Electroporation of pyc112 into LS3702
Strain or LS4547 ftsa xylx::pxylx-ftsa ppvan-yfp-tola Electroporation of pyc112 into EG083 AM52 ftsn vana::pvan-ftsn (Moll & Thanbichler, 2009) LS4626 ftsn vana::pvan-ftsn xylx::pxylx-yfp-tola Electroporation of pyc117 into AM52 pxyfpn-2 For integration of N-terminal YFP fusions at xylx locus (Thanbichler et al., 2007) pxgfpn-2 For integration of N-terminal GFP fusions at xylx locus (Thanbichler et al., 2007) pxmchyn-2 For integration of N-terminal mcherry fusions at xylx locus (Thanbichler et al., 2007) pxmchyc-2 For integration of C-terminal mcherry fusions at xylx locus (Thanbichler et al., 2007) pyc103 pyc104 pyc105 pyc106 pyc107 A PCR fragment of the tolq gene (without stop codon) obtained with primers TTTTGGTACCatggacgccgcggccgcc and TTTTGAATTCCCgacccgctcggccaggcgacg was digested with KpnI and EcoRI and cloned into pxyfpc-2 A PCR fragment of the tolr (with stop codon) obtained with primers TTTTGGTACCatggcgatgtcctccaacgacgcctt and TTTTGAATTCctactgcgcaggccgcaggtcgg was digested with KpnI and EcoRI and cloned into pxgfpn-2 A PCR fragment of the tola (with stop codon) obtained with primers TTTTGGTACCatgagcgctcgccgcgaacagactct and TTTTGAATTCtcaacgcgaacaggcctgttttgcat was digested with KpnI and EcoRI and cloned into pxgfpn-2 A PCR fragment of the tolb (with stop codon) obtained with primers TTTTGGTACCatgcgccttagagccctgctgctgat and TTTTGAATTCctagtccagaaggggcgaccaggcgg was digested with KpnI and EcoRI and cloned into pxmchyn-2 A PCR fragment of the pal (without stop codon) obtained with primers TTTTGGTACCttgaggagaaactggatgagcttcgacaccc and TTTTGAATTCCCgcgagcgccgtccgtgatggc was digested with KpnI and EcoRI and cloned into pxmchyc-2 pnpts138 For gene replacement by double homologous recombination M.R.K. Alley, unpublished pyc101 pnpts138 carrying tola upstream and downstream 500 bp. The flanking regions of tola were amplified using chromosomal DNA as template and the primer pairs ttttaagcttcgcgacgggcgggcgc with
Strain or TTTTGGATCCggccggagacagagtctgttcgcg and TTTTGGATCCctcaacttcaatgcaaaacaggcctgttcg with TTTTGAATTCggtcaggcgctcatagaccgcgtcg. The PCR fragments were digested with HindIII and BamHI and with BamHI and EcoRI, respectively. The two PCRs were triple ligated into pnpts138 digest with HindIII and EcoRI. pyc102 pnpts138 carrying pal upstream and downstream 500 bp. The flanking regions of pal were amplified using chromosomal DNA as template and the primer pairs TTTTCTGCAGtggccgttacaccacgccggtctgg with TTTTGGTACCgcgctgggtgtcgaagctcatccagt and TTTTGGTACCaacggccgcacggccatcacgg with TTTTGAATTCcaggtcggccagcgtcttctcaatcg. The PCR fragments were digested with PstI and KpnI and with KpnI and EcoRI, respectively. The two PCRs were triple ligated into pnpts138 digest with PstI and EcoRI. pmt69 For integration of genes at the xylx locus (Thanbichler & Shapiro, 2006) pyc200 tola inserted between NdeI and EcoRI sites into pmt69 pyc201 A PCR fragment of the pal obtained with primers TTTTCATATGaggagaaactggatgagcttcgacaccc and TTTTGAATTCtcagcgagcgccgtccgtgatggc was digested with NdeI and EcoRI and cloned into pmt69 pxmcs-2 For generation xylose dependent depletion strains (Thanbichler et al., 2007) pyc103 A PCR fragment of the tolb (1-400 bp) obtained with primers TTTTCATatgaacaaggagaccccgatgcgcctta and TTTTGGTACCcccttctcgccggtcaggcgct was digested with NdeI and KpnI and cloned into pxmcs-2 pvchyc-2 For integration of C-terminal mcherry fusions at vana locus (Thanbichler et al., 2007) pyc107 prvyfpc-5 prvyfpn-5 pyc110 The KpnI and EcoRI digested fragment from pyc107 was cloned into pvchyc-2 replicating plasmid for vanillate-inducible C-terminal YFP fusions replicating plasmid for vanllilate-inducible N-terminal YFP fusions The KpnI and EcoRI digested fragment from pyc103 was cloned into prvyfpn-5 (Thanbichler et al., 2007) (Thanbichler et al., 2007)
Strain or pyc111 pyc112 The KpnI and EcoRI digested fragment from pyc104 was cloned into prvyfpc-5 The KpnI and EcoRI digested fragment from pyc105 was cloned into prvyfpn-5 pxflgc-2 For integration of C-terminal M2 tag fusions at xylx locus (Thanbichler et al., 2007) pyc119 A PCR fragment of the tipn (without stop codon) obtained with primers TTTTGGTACCcgttcacgcgccgcgccg and TTTTGAATTCCCggccagatcgccgctcgccg was digested with KpnI and EcoRI and inserted into pxflgc-2 pvchyc-4 For integration of C-terminal mcherry fusions at vana locus (Thanbichler et al., 2007) pyc113 A PCR fragment of the pal (without stop codon) obtained with primers TTTTGGTACCttgaggagaaactggatgagcttcgacaccc and TTTTGAATTCCCgcgagcgccgtccgtgatggc was digested with KpnI and EcoRI and cloned into pvchyc-4 pxgfpc-4 For integration of C-terminal GFP fusions at xylx locus (Thanbichler et al., 2007) pyc115 A PCR fragment of the tola-m2 (with stop codon) obtained with primers TTTTGGTACCatgagcgctcgccgcgaacagactct and TTTTgctagcttacttgtcatcgtcatccttgtagtcggaccggtgacgcgtaacgttc gaattcggacgcgaacaggcctgttttgcatt was digested with KpnI and NheI and cloned into pxgfpc-4 digest with KpnI and NheI pxyfpn-2 For integration of N-terminal YFP fusions at xylx locus (Thanbichler et al., 2007) pyc117 The KpnI and EcoRI digested fragment from pyc105 was cloned into pxyfpn-2 Φ indicates generalized transduction, as mediated by bacteriophage ΦCr30. For example, x Φ(LS3785) means that a bacteriophage lysate made from LS3785 was used to infect. References Bowman, G. R., L. R. Comolli, J. Zhu, M. Eckart, M. Koenig, K. H. Downing, W. E. Moerner, T. Earnest & L. Shapiro, (2008) A polymeric protein anchors the chromosomal origin/parb complex at a bacterial cell pole. Cell 134: 945-955. Evinger, M. & N. Agabian, (1977) Envelope-associated nucleoid from Caulobacter crescentus stalked and swarmer cells. J Bacteriol 132: 294-301. Huitema, E., S. Pritchard, D. Matteson, S. K. Radhakrishnan & P. H. Viollier, (2006) Bacterial birth scar proteins mark future flagellum assembly site. Cell 124: 1025-1037.
Matroule, J. Y., H. Lam, D. T. Burnette & C. Jacobs-Wagner, (2004) Cytokinesis monitoring during development; rapid pole-to-pole shuttling of a signaling protein by localized kinase and phosphatase in Caulobacter. Cell 118: 579-590. Moll, A. & M. Thanbichler, (2009) FtsN-like proteins are conserved components of the cell division machinery in proteobacteria. Mol Microbiol 72: 1037-1053. Thanbichler, M., A. A. Iniesta & L. Shapiro, (2007) A comprehensive set of plasmids for vanillate- and xylose-inducible gene expression in Caulobacter crescentus. Nucleic Acids Res 35: e137. Thanbichler, M. & L. Shapiro, (2006) MipZ, a spatial regulator coordinating chromosome segregation with cell division in Caulobacter. Cell 126: 147-162. Viollier, P., N. Sternheim & L. Shapiro, (2002) A dynamically localized histidine kinase controls the asymmetric distribution of polar pili proteins. EMBO J 21: 4420-4428. Wang, Y., B. D. Jones & Y. V. Brun, (2001) A set of ftsz mutants blocked at different stages of cell division in Caulobacter. Mol Microbiol 40: 347-360.