DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that make up a protein nucleotide sequence of His protein Amino acid sequence of His protein
Protein Synthesis = Gene Expression The process in which the instructions encoded by a gene are used to build a protein Gene DNA in the nucleus transcription mrna translation made in nucleus, exits out of a pore in the nuclear envelope and finds a ribosome in the cytoplasm polypeptide built out of amino acids by a ribosome in the cytoplasm using instructions from an mrna protein Final resulting molecule after polypeptide is modified and folded into final shape in the rough ER Packaged into a vesicle in the golgi and shipped out to where it is needed
Transcription RNA polymerase makes an mrna (messenger RNA) copy of a gene occurs in cytoplasm of prokaryotes, nucleus of eukaryotes Enables cell to make many copies of a gene so that a lot of protein can be made at one time Enables eukaryotic cells to keep DNA protected in the nucleus, only mrna copies of genes leave the nucleus
Transcription Initiation RNA polymerase binds to a region on DNA known as the promoter, which signals the start of a gene Promoters are specific to genes RNA polymerase does not need a primer Transcription factors assemble at the promoter forming a transcription initiation complex activator proteins help stabilize the complex 1) INITIATION Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor (eukaryotes) HONORS
Transcription Elongation 1) INITIATION RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) recall RNA uses uracil instead of thymine AGTCAT UCAGUA HONORS
Transcription Elongation The gene occurs on only one of the DNA strands; each strand possesses a separate set of genes RNA polymerase slides down the template strand connecting together RNA nucleotides
Transcription Termination A region on DNA known as the terminator signals the stop of a gene 1) INITIATION RNA polymerase separates from the mrna and the DNA HONORS
Alternative Splicing (eukaryotes only) Exons are coding regions provide instructions for one or more proteins) Introns are removed different combinations of exons form different mrna resulting in multiple proteins from the same gene Humans have 30,000 genes but are capable of producing 100,000 proteins HONORS
Web Resources Transcription http://www.biostudio.com/d_%20transcription.htm http://www.youtube.com/watch?v=wsofh466lqk http://www.dnalc.org/resources/3d/transcriptionbasic_withfx.html Alternative Splicing http://www.youtube.com/watch?v=fvuawbgw_pq&feature=related
Translation mrna is used by ribosome to build polypeptides (Ribosomes attach to the mrna and use its sequence of nucleotides to determine the order of amino acids in the polypeptide) occurs in cytoplasm of prokaryotes and eukaryotes some polypeptides feed directly into rough ER in eukaryotes where they are modified and folded into the final protein Transcription mrna trna synthesis Translation
Protein Synthesis mrna Translation Initiation Start codon signals where the gene begins (at 5 end of mrna) Translation 5 3 AUGGACAUUGAACCG start codon
Translation Initiation Start codon signals where the gene begins (at 5 end of mrna) Ribosome binding site on the mrna binds to a small ribosomal subunit Then this complex binds to a large ribosomal subunit forming the complete ribosome
Translation Scanning The ribosome moves in 5 to 3 direction reading the mrna and assembling amino acids into the correct polypeptide
Translation Scanning Transcription trna synthesis Every three mrna nucleotides (codon) specify an amino acid mrna Translation
Translation Scanning Each trna carries a specific amino acid trna have an anticodon region that specifically binds to its codon anticodon
Protein Synthesis Translation Termination Ribosome disengages from the mrna when it encounters a stop codon
Web Resources Translation Eukaryotic: http://www.youtube.com/watch?v=5bledd-pstq&feature=related Prokaryotic: http://www.biostudio.com/d_%20protein%20synthesis%20prokaryotic.htm http://www.biostudio.com/d_%20peptide%20bond%20formation.htm http://www.johnkyrk.com/dnatranslation.html http://www.dnalc.org/resources/3d/translationbasic_withfx0.html http://www.dnalc.org/resources/3d/translationadvanced.html
Post-Translational Modifications Polypeptide is modified in the rough ER this might include cutting out sections and/or cut a section from one part of the polypeptide and moving it to another part Chaperone proteins help to fold the polypeptide into its final tertiary shape. Now it is called a protein.
Rough Endoplasmic Reticulum (ER) Folded membrane that forms compartments where newly synthesized proteins are processed (cut, joined, folded into their final shape) Ribosomes bind to rough ER when they start to synthesize proteins that are intended to be exported from the cell the proteins enter the ER directly from the ribosome
Golgi Apparatus Folded membranes form compartments that each contain different enzymes which selectively modify the contents depending on where they are destined to end up Processes and packages macromolecules produced by the cell (e.g. proteins and lipids) sent out as excretory vesicles labeled for their destination
Multiple RNA polymerases can engage a gene at one time Translation Multiple ribosomes can engage a single mrna at one time Transcription DNA mrnas
Eukaryotes: transcription occurs in the nucleus and translation occurs in the cytoplasm Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm
There are three main types of RNA: 1. mrna (messenger RNA) - RNA copy of a gene used as a template for protein synthesis 2. rrna (ribosomal RNA) - part of structure of ribosomes 3. trna (transfer RNA) - amino acid carrier that matches to mrna codon
Practice Question Translate the following mrna sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC
Practice Question Translate the following mrna sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine Tyrosine Histidine Threonine Histidine Proline Serine Serine Serine - Serine
Practice Question Translate the following mrna sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine Tyrosine Histidine Threonine Histidine Proline Serine Serine Serine - Serine Ser Tyr His Thr His Pro Ser Ser Ser - Ser
Practice Question Translate the following mrna sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine Tyrosine Histidine Threonine Histidine Proline Serine Serine Serine - Serine Ser Tyr His Thr His Pro Ser Ser Ser - Ser S Y H T H P S S S - S
Protein Synthesis = Gene Expression Process in which a gene is used to build a protein resulting in the presence of a particular phenotype (physical characteristic) Phenotypic variation among organisms is due to genotypic variation (differences in the sequence of their DNA bases) Differences exist between species and within a species Different genes (genomes) different proteins (proteomes) Different versions of the same gene = alleles Differences in gene expression = epigenetics
Web Resources Insulin Example of Protein Synthesis http://www.biotopics.co.uk/as/insulinproteinstructure.html Hemoglobin Example of Protein Synthesis http://www.biotopics.co.uk/as/insulinproteinstructure.html Collagen Example of Protein Synthesis http://www.biotopics.co.uk/jmolapplet/collagen.html