Gene expression
Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic function and another one with a contractile function. Why do they have different functions?
DNA and RNA DNA RNA Sugar: Bases: Strands:
Gene expression involves two steps process of how the information in gene (DNA) is used to make a polypeptide(protein
In the process of gene expression, transcription creates a using as a template, and translation creates a using the information stored in. A. DNA, DNA, protein, DNA B. mrna, DNA, protein, mrna C. Protein, mrna, mrna, DNA
The Genetic Code is written in a three letter words using a four letter alphabet From DNA to RNA: Only one of the strand of DNA is used 3 to 5 This conversion is complementary Base (DNA) to base (RNA) The mrna is 5 to 3 From RNA to PROTEIN: This conversion uses 3 bases (mrna) to 1 amino acid (Protein) 1 codon for 1 amino acid The sequence of bases (A,T,C,G) of the nucleotides in a strand of DNA codes for the sequence of amino acids in a protein
The codon table for mrna If a DNA template has the following sequence ATTACGATCTGCACAAGATCCT What would be the sequence of amino acids?
The codon table for mrna reveals some features What is the DNA sequence That all genes begin with? What is the DNA sequence that genes end with? Why is the genetic code redundant? Why is the genetic code Unambiguous? The code depends on a Correct reading frame The code is universal
Gene organization Gene contains: - A promoter sequence: directs where transcription begins. - Transcription unit: the part of the gene that will actually be transcribed into RNA
Transcription proceeds in three stages Initiation : Proteins called transcription factors Bind to the promoter RNA polymerase II binds This forms the transcription initiation Complex The DNA is unwound at the front of The polymerase and exposes the Template strand They enzyme begins the synthesis of in the 5 to 3 direction
Elongation and termination of transcription Elongation: RNA polymerase II moves along the DNA Unwinding it and adding new RNA nucleotides Behind it the DNA strands reform into A double helix Termination: The RNA molecule is released from the template DNA
Transcription of non-coding RNA genes occurs in a similar way Coding genes Are the genes that code For the mrna protein Noncoding genes Code for trna and rrna RNA polymerase III Transcribes trna genes RNA polymerase I Transcribes rrna Eukaryotic cells modify mrna before the RNA leaves the nucleus, why?
Which of the following statements about transcription is FALSE? 1. In RNA, U, rather than T, pairs with A 2. The RNA molecule is built one nucleotide at a time 3. Both DNA strands serve as the template for one RNA 4. Transcription begins when RNA polymerase attaches to the promoter 5. As the RNA molecule is produced, it peels away from its DNA template
Gene organization Gene contains: - A promoter sequence: directs where transcription begins. - Transcription unit: the part of the gene that will actually be transcribed into RNA, contains Exons: sequences that will be expressed (code for the sequence of amino acids) Introns: sequences that are interrupt the code (do not code for the sequence) introns need to be removed
RNA processing: modifications to the ends CAP AND TAIL: 5 end gets a cap, Consisting of guanine That is connected to the rest by Three phosphate groups The cap is the site where ribosomes attach to mrna At the start of translation 3 side has polyadenylation signal : a sequence where proteins bind and cleave after it The Poly(A) polymerase adds a chain of adenine nucleotides which is called the poly(a) tail
RNA processing: removing interrupting sequences mrna SPLICING: Process of removing introns and joins exons Which takes place in the spliceosome, a complex formed when a handful of Small nuclear ribonucleoprotein particles Join the intron
Alternative splicing: one gene can code for different polypeptides
Translation: from RNA to polypeptide mrna moves along the ribosome, while codons are translated into amino acids by trna Amino acid Enzyme Amino acid attachment
trnas Are Small RNAs That Bring Amino Acids to the Ribosome Amino acid Accurate translation, Requires 2 instances of Recognition 1) That the correct trna carries The correct amino acid Catalyzed by aminoacyl-trna synthetases Enzyme Amino acid attachment Note: charged trna 2) The anti codon Pairs with correct mrna codon
Ribosomes Functions in: - Support the H-bonding of codon and anitcodon - rrna catalyses the peptide bonds between amino acids (ribozyme)
Translation takes place in three steps Initiation Elongation: Codon recognition, peptide bond formation and translocation Termination The energy of GTP hydrolysis to fuels each of the three stages.
Initiation: Brings together the mrna, the first trna and the two subunits of the ribosome
Elongation : amino acids are added one by one in a three step process
Check your knowledge A sequence of pictures of protein synthesis shows a ribosome holding two transfer RNAs. One trna has a polypeptide chain attached to it in the P site; the other trna has a single amino acid attached to it in the A site. What does the next picture show? A. A third trna with an amino acid joins the pair on the ribosome. B. The trna with the polypeptide chain leaves the ribosome. C. The polypeptide chain moves over and bonds to the single amino acid. D. The amino acid moves over and bonds to the polypeptide chain. E. The trna with the single amino acid leaves the ribosome.
Termination: stop codon is reached the ribosome and other components disassemble
During translation in a eukaryotic cell. 1. trna carries amino acid molecules to the nucleus, where they are added to a growing protein chain 2. proteins are synthesized at ribosomes, according to instructions carried by mrna 3. French cells are able to speak to German cells 4. mrna is synthesized by the bonding of free nucleotides to the bases on the template strand of DNA 5. ribosomes move into the nucleus
Example 1: DNA: T A C G C G C C T A G G G G G T G G mrna: AA: Example 2: DNA: T T C G A T T A G A T G C C G A A G mrna: trna: AA: Example 3: DNA: C _ G _ A _ A _ C _ T _ mrna: _ U _ A C A _ G A _ trna: _ A U G _ U _ U G G _ U C C _ G _ A AA:
Match the player of protein synthesis in this construction analogy A. Blue prints B. Supervisor C. Trucks D. Finished building E. Concrete & lumber F. Master Plans G. Building site H. Architect s vault Nucleus DNA Cytoplasm Ribosome mrna trna Amino acids Protein
Newly synthesized polypeptides are processed and folded into finished form Most eukaryotic proteins are inactive and unfinished when the ribosome releases them. -Proteins need to fold into their 3D shapes. Chaperones are proteins that help in this process - Post translational modifications may be required: adding sugar, lipids or other molecules to some amino acids sections of the polypeptide may be removed (this also supports the idea that one gene many proteins)
Mutations are changes in a sequence of DNA These can be inherited or acquired These changes get transcribed And translated Result?
Types of small scale mutations that affect mrna sequence
Check your knowledge If a virus infects a cell and randomly inserts many short segments of DNA containing a stop codon throughout the organism's chromosomes. This will probably cause. A. no bad effects, as long as the stop codons are not also inserted into trna B. incorrect pairing between mrna codons and amino acids C. manufactured proteins to be short and defective D. the DNA to break up into thousands of short segments
Mutations can be bad, neutral or CFTR gene Good.
Mutations are the source of life s diversity