Part I: Working with DNA MCDB 1041 3/15/13 Working with DNA and Biotechnology You work in a clinic doing prenatal testing and genetic counseling. You use PCR analysis combined with restriction enzyme digests to determine whether fetuses are affected by cystic fibrosis, caused by a mutation on both copies of chromosome 7, in the cystic fibrosis (CF) gene. Below is a region of DNA (from the middle of the CF gene). Sequence of normal CF gene: 5 ACGCCGCTACGT TAGACTTCGCTACAAGACGG 3 3 TGCGGCG ATGCAATCTGAAGCGATGTTCTGCC 5 Sequence of mutant CF gene 5 ACGCCGCTACGT TAGAATTCGCTACAAGACGG 3 3 TGCGGCG ATGCAATCTTAAGCGATGTTCTGCC 5 1. Circle the mutation in the sequence above. One of the restriction enzymes (R.E.) you can use cuts at the following sequence, at the stars: G*AATTC CTTAA*G 2. Mark on the sequence(s) above where this R.E. will cut the DNA. You have been charged with doing DNA analysis on three recently born babies. You determine that one child is normal (no mutations in the cystic fibrosis gene on chromosome 7), one is a carrier (one mutation), and one has cystic fibrosis (a mutation on each chromosome) see the diagram below. The line in the diagram indicates the site of the mutation within the CF gene that you just found in questions 8 and 9 above. The CF gene DNA is isolated from cells from the fetus cells by PCR, and is 10 KB in length. The restriction enzyme shown above cuts the mutant CF gene into two pieces (7 kb and 3 kb). You cut your samples of DNA from each fetus, and then run the DNA on the gel. normal Cystic fibrosis carrier
3. What would you expect to see when you run the gel? Draw the bands each child has. Make sure to indicate the correct intensity of each band (ie, more DNA, darker band). Child A is normal. Child B has cystic fibrosis Child C is a carrier A B C 12 KB 11 KB 10 KB 9 KB 6 KB 3 KB 1 KB 4. Below is a pedigree showing inheritance of an autosomal recessive disease. Carriers are marked. The gene being analyzed is 15 KB in length normally. The mutation is a deletion of 2 KB. For each individual, imagine you have done PCR to amplify just this gene sequence from their DNA. For each numbered individual, draw in the band(s) of DNA on the gel that would result from the PCR. 1 2 3 4 5 ladder 1 2 20 15 3 4 5 10 8 6 +
5. Let s say you are testing newborns to see if they have or are carriers of an X-linked recessive disease, hemophilia (due to a mutation in coagulation factor VIII also called F8 -- which results in failure of blood to clot properly). a. Using the white boards: make up a pedigree for three generations that shows unaffected, affected and carrier individuals in a pedigree for hemophilia. You can copy your pedigree into the space below, so you can refer back to it later. b. Say that the F8 gene is 15 KB in length. If you wanted to analyze whether individuals in a family had or carried hemophilia before they showed any symptoms, what kind of mutations would you be able to assay using just PCR and gel electrophoresis. What kind of mutations could you assay using PCR, restriction enzyme digests and gel electrophoresis? c. Imagine that the mutation you are assaying that leads to hemophilia is a single base change that removes a restriction enzyme site. If that site is normally at the 5 KB point of the gene, indicate what results would be expected for unaffected, affected and carrier individuals by drawing a gel and drawing the pattern on the gel expected for your analysis of each individual in the pedigree.
Part II Biotechnology: Genetically Modified Foods What is a genetically modified food? The U.S. is one of the primary producers of GMO foods in the world. The creation of GMOs involves using recombinant DNA technology to place genes from one organism into another of a different species to confer a useful trait. For example, the company Monsanto developed a pest-resistant potato plant by incorporating a gene from a soil bacterium into the genome of a potato plant: this gene produces a compound that kills the Colorado Potato Beetle. These potatoes are commercially grown in the U.S. The pesticide that used to be sprayed on the potatoes to fight the beetle is no longer necessary. How do you generate the recombinant DNA that is used to make a GMO? Let s take the creation of a product called golden rice as an example. Vitamin A deficiency is a problem in the developing world, especially for pregnant women and children. Nearly 400 million people in the world are at risk of a vitamin A deficiency, which can lead to blindness and an increase in the severity of infections in young children. Foods like carrots, sweet potatoes, and spinach contain β- carotene (precursor to vitamin A), but these foods are not always available in the developing world. By adding a gene called phytoene synthase (psy) from the daffodil plant, plus a promoter region that determines where the gene will be expressed, β- carotene will accumulate in the rice grain, and be converted into Vitamin A before being harvested. To make golden rice, we first need to generate recombinant DNA. To do this, we use the bacterial system described in class. We need to put different pieces of DNA together and then amplify them, which is why we use this technique as opposed to just PCR. The picture at right represents a piece of double- stranded DNA from daffodil. This DNA includes the daffodil phytoene synthase gene (psy), as well as additional sequences of E P B H B DNA. Each line represent 1 Kilobase (1KB). Each line represent 1 Kilobase (1KB). You can amplify this 12 KB This DNA sequence can be cut by 4 different restriction enzymes E=Eco RI P=Pst1 B=BglII H=HindIII). Below is a list of the nucleotide sequences that occur at two of these restriction enzyme sites, along with the actual names of the REs. The psy gene is between the E and H restriction enzyme sites. Letter on the DNA sequence Restriction Enzyme Recognition and cutting sequence Name of Restriction Enzyme E G* A A T T C Eco RI C T T A A *G H C T G C A*G G *A C G T C Hind III 1. In the strand of DNA shown below, find the restriction enzyme sites. TATAAGATTGCGATGCCCTGCAGCTATTCGGCTGCCTAAAATCGGCCCCTAAGAATTCTTATCG ATATTCTAACGCTACGGGACGTCGATAAGCCGACGGATTTTAGCCGGGGATTCTTAAGAATAGC If this sequence (above) of DNA were cut with both E and H restriction enzymes, how many pieces would be created?
2. Find the band (circle it) on the gel below that contains that should contain the psy gene of interest. E P B H H+E B+P Ladder(DNA of known sizes for referen ce) 12 KB 11 KB 10 KB 9 KB 6 KB 3 KB 1 KB 3. You cut the daffodil psy DNA band out of the gel and purify the DNA from the gel. Now you want to add another piece of DNA to this piece: the phyotene desaturase (crt 1) gene from a soil bacterium. These two genes together will allow for the rice seed to contain beta carotene. The crt1 gene is represented below, with letters to indicate the location of restriction enzyme sites (the lines no longer represent 1 KB, so just look at the location of the RE sites). E P B H B B P B E Crt gene. Coding sequence extends from P to E sites. If you want these two genes to be hooked in sequence, and put into the bacterial plasmid shown below, with the crt1 gene in front of the psy gene: a. What restriction enzymes should you use to cut out the crt gene? b. What restriction enzymes should you then use to cut the plasmid (you want to put BOTH genes into the plasmid to be replicated as a unit) 9:/$..$ %&'()&'*+,,'(-$.('*-"+(-$ (-/-01+2/-$*+"3-"$ 4#,5$...$ 60'$7.$ %(1$8$ 9:/$..$!"#$
4. Once you cut and piece all your DNA sequences back together, you ll have a plasmid that contains the crt and psy genes, and you can put this plasmid into bacteria to replicate. Later, when you want to isolate the DNA from the bacteria, you ll need to know what size the DNA is. If the plasmid is 3.5 KB in size, the psy DNA is 4 KB, and the crt1 is 1 KB, draw a gel below showing the plasmid WITH the two pieces of DNA, and in a separate lane, the result of cutting the plasmid with the enzymes HindIII and Pst1. uncut cut with H+P 9 KB 8 7 6 4 3 1 Getting more copies of the recombinant DNA: The bacteria now replicate in culture, and the scientist selects the bacterial colonies that contain the recombinant DNA. 5. You might have noticed that instead of an antibiotic resistance selectable marker on the plasmid there is a phosphomannose isomerase selectable marker. Why might you want to use the phosphomannose isomerase selectable marker instead of the antibiotic resistance gene normally present in these plasmids? Creating the genetically modified plant In making transgenic plants, it is relatively easy to get the recombinant piece of DNA into the plant. The plasmid containing the recombinant DNA is incorporated into the genome of a bacterium called Agrobacteria. These bacteria naturally infect plant seeds. If the Agrobacteria are made to contain the gene of interest, as described above, then when the bacteria infects the plant, it transfers in this recombinant DNA. If the bacterial infection doesn't work, there is another technique in which the recombinant DNA is essentially injected into the plant seeds (called the "biolistic" method). 6. Your ultimate goal is to generate rice that expresses the psy gene from daffodil in the seed of the rice, where it will provide b- carotene to those eating it. Starting back from the beginning, outline the steps you should take to make a plasmid that contains the psy gene from daffodils.
In 2000, rice that contained daffodil phytoene synthase (psy) and bacterial phyotene desaturase (crt 1) was introduced to the world. This rice is called Golden Rice. Its introduction was met with praise from some groups and opposition from other groups (like Greenpeace). Members of Greenpeace are opposed to all genetically modified foods. China and India are starting to farm Golden Rice and researchers are now trying to figure out to add vitamins A and E, iron, and zinc into bananas, cassava, rice, and sorghum. Interestingly, 12 years later, the use of golden rice is still minimal. A lot of this has to do with politics. If you are interested, here are several links where you can read more about golden rice: Pro: http://www.goldenrice.org/ Con: http://www.i-sis.org.uk/rice.php Right here in Boulder county, people have also debated the use of farm lands to grow genetically modified crops (beets in this case). The originally proposed ban was NOT upheld this past December, so such crops can still be grown in Boulder county. See these links for some interesting articles in the Boulder Daily Camera: Pro: http://www.dailycamera.com/ci_18912267 Con: http://www.commondreams.org/view/2011/05/08-2
MCDB 1041 Activity 7: to turn in to your LA as a group Your names: 1. Please copy here (from Part 1 #5), the pedigree and gel you created to identify people who were carriers or had hemophilia 2. You are in the grocery store in the US and you see a sale on golden rice. Presuming it tastes the same as regular rice, would you buy it and eat it? If you were taking a trip to a developing country and it was legal to do so, would you bring golden rice seed to the community? Why or why not? Please consider both science and politics!