Recent Advancements in Analytical Methods of Drug Detection Mario Thevis Gene and Cell Doping Symposium Beijing, June 5/6, 2013
www.wada-ama.org
Challenges at the time accepted by anti-doping authorities and sports drug testing laboratories - use of state-of-the-art instrumentation - steep learning curve concerning analytical methodologies Methylamphetamine Hitachi RMU 6E 12s/scan LOD: 4 µg/ml Amphetamine Beckett et al. J. Pharm. Pharmacol. 1967; 19: 273
Main tools have always been chromatography / mass spectrometry - Monopoly of gas chromatography mass spectrometry until early 2000 *Limitation: only volatile substances can be measured / extensive derivatization required *Advantage: robustness, reproducibility, steroid profiling, IRMS
Main tools have always been chromatography / mass spectrometry - Availability of new generation liquid chromatography mass spectrometry instruments *Peptides, proteins, carbohydrates as well as nucleotides can be measured *commonly no / little derivatization and sample preparation required - Substantial improvements in resolution and mass accuracy
Abundance (%) Zentrum für Präventive Dopingforschung / Institut für Biochemie Main tools have always been chromatography / mass spectrometry Human Insulin Humalog Lispro Time (ms) Thevis et al. Forensic Sci Int. 2011
Complementary methods - Immunological methods (e.g. hcg, LH, hgh) - 1- and 2-D electrophoretic/immunological methods (e.g. EPO, proteases) Reichel Drug Test. Analysis 2009
Combined methods - Immunopurification for MS-based methodologies (e.g. insulins, GHRH, LHRH, CRH) - SPE for LC-MS/MS-based methodologies (e.g. GHRPs, TB-500, AOD-9604, LHRH) - Bottom-up targeted proteomics approaches (e.g. IGF-1, hematide) - Bottom-up targeted `RNomics approaches (e.g. sirna)
Currently: detection assays composed by methodology GC-MS LC-MS(/MS) Complementary
Modern mass spectrometry-based detection assay Major advantages: - Combined targeted AND non-targeted analyses - Retrospective data mining - Comprehensive coverage of most prohibited substances - Structure-based identification of related compounds - Determination of elemental composition Instrumentation and methodologies principally available in all accredited doping control laboratories!
Modern mass spectrometry-based detection assay Recent advances - Example Kurreck J. Angew. Chem. Int. Ed. 2009, 48: 1378
Small Interfering RNA (sirna) From: RNAi Therapeutics: How Likely, How Soon? Robinson R PLoS Biology Vol. 2, No. 1, e28 doi:10.1371/journal.pbio.0020028
Small Interfering RNA (sirna) Zentrum für Präventive Dopingforschung / Institut für Biochemie
WADA-supported project Model sirna designed from the myostatin mrna of Rattus norvegicus ATGATTCAAAAACCGCAAATGTATGTTTATATTTACCTGTTTGTGCTGATTGCTGCTGGCCCAG TGGATCTAAATGAGGACAGTGAGAGAGAGGCGAATGTGGAAAAAGAGGGGCTGTGTAATGCG Sense TGTGCGTGGAGACAAAACACAAGGTACTCCAGAATAGAAGCCATAAAAATTCAAATCCTCAGT AAACTCCGCCTGGAAACAGCGCCTAACATCAGCAAAGATGCTATAAGACAACTTCTGCCCAGA GCGCCTCCACTCCGGGAACTGATCGATCAGTACGACGTCCAGAGGGATGACAGCAGTGACG 5 -ACCGCAAAUGUAUGUUUAUdtdt-3 3`-dtdtUGGCGUUUACAUACAAAUA-5 GCTCTTTGGAAGATGACGATTATCACGCTACCACGGAAACAATCATTACCATGCCTACCGAGT CTGACTTTCTAATGCAAGCGGATGGAAAGCCCAAATGTTGCTTTTTTAAATTTAGCTCTAAAAT ACAGTACAACAAAGTGGTAAAGGCCCAGCTGTGGATATATCTGAGAGCCGTCAAGACTCCTAC AACAGTGTTTGTGCAAATCCTGAGACTCATCAAACCCATGAAAGACGGTACAAGGTATACCGG AATCCGATCTCTGAAACTTGACATGAGCCCAGGCACTGGTATTTGGCAGAGTATTGATGTGAA Antisense GACAGTGTTGCAAAATTGGCTCAAACAGCCTGAATCCAACTTAGGCATTGAAATCAAAGCTTT GGATGAGAATGGGCATGATCTTGCTGTAACCTTCCCAGGACCAGGAGAAGATGGGCTGAATC CCTTTTTAGAAGTCAAAGTAACAGACACACCCAAGAGGTCCCGGAGAGACTTTGGGCTTGACT GTGATGAACACTCCACGGAATCGCGGTGCTGTCGCTACCCCCTCACGGTCGATTTCGAAGCC TTTGGATGGGACTGGATTATTGCACCCAAAAGATATAAGGCTAATTACTGCTCTGGAGAGTGT GAATTTGTGTTCTTACAAAAATATCCGCATACTCATCTTGTGCACCAAGCAAACCCCAGAGGCT CGGCAGGCCCTTGCTGCACGCCAACAAAAATGTCTCCCATTAATATGCTATATTTTAATGGCAA AGAACAAATAATATATGGGAAAATTCCAGCCATGGTAGTAGACCGGTGTGGGTGCTCGTGA From NCBI Reference Sequence: NM_019151.1
Selection of RNA nucleotide modifications Kurreck J. Angew. Chem. Int. Ed. 2009, 48: 1378
In vivo experiments Rats (Rattus norvegicus, WISTAR) treated with 1 mg/kg of sirna (0.33mg/rat) Three rats per sirna, control group treated with water Treatment by a single i.v. administration Sample collection of urine and plasma after 4, 9, 24, 33 and 48 hours Free access to food and water
-200 µl of urine (DEPC treated) Workflow add ethanol load sample column 1 add ethanol mirna purification spin columns from Invitrogen (Karlsruhe, Germany) load sample column 2 wash Hydrolysis with 0.1 M NaOH elute with water LC-HRMS *Kohler M, Thomas A, Walpurgis K, Schänzer W, Thevis M. Anal Bioanal Chem. 2010;398:1305-13012
Hydrolysed rat urine sample (treated with sirna 1 (4h)) RT: 2.05 m/z= 378.02-378.03 Gmps RT: 3.47 NL: 2.21E5 S P O O 362.032 RT: 1.52 m/z= 339.00-339.01 m/z= 362.02-362.03 RT: 2.31 Umps RT: 3.47 NL: 1.33E5 NL: 6.34E5 94.934 134.045 226.977 328.043 Amps 80 120 160 200 m/z 240 280300 340 380 m/z= 504.06-504.09 A 2`-OMe U 2`-OMe A RT: 4.68 NL: 6.89E5 m/z= 984.13-984.15 A 2 -F C 2 -F A RT: 4.68 NL: 7.57E4 m/z= 626.12-626.13 GG RT: 4.71 NL: 4.05E6 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0 Time (min)
Hydrolysed rat urine sample (control group (4h)) m/z= 378.02-378.03 NL: 0 Gmps m/z= 339.00-339.01 NL: 5.71E3 Umps m/z= 362.02-362.03 NL: 0 Amps m/z= 504.06-504.09 NL: 0 A 2`-OMe U 2`-OMe A m/z= 984.13-984.15 NL: 0 A 2 -F C 2 -F A m/z= 626.12-626.13 NL: 0 GG 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5
RT: 0.69-12.16 80 60 40 20 0 80 60 40 20 0 80 60 40 20 0 80 60 40 20 0 SM: 9G RT: 2.92 RT: 2.46 RT: 5.76 RT: 5.71 RT: 5.56 1 2 3 4 5 6 7 8 9 10 11 12 Time (min) RT: 9.62 NL: 1.61E4 m/z= 349.50-349.52 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww NL: 8.48E4 m/z= 869.77-869.80 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww NL: 1.09E5 m/z= 809.09-809.12 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww NL: 4.99E4 m/z= 644.57-644.59 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww Zentrum für Präventive Dopingforschung / Institut für Biochemie -200 µl of urine (DEPC treated) Workflow add ethanol load sample column 1 mirna purification add ethanol spin columns from Invitrogen (Karlsruhe, Germany) load sample column 2 wash Hydrolysis with 0.1 M NaOH LC-HRMS elute with water LC-HRMS Relative Abundance
Relative Abundance Relative Abundance Zentrum für Präventive Dopingforschung / Institut für Biochemie LC-HRMS analysis of intact sirna from rat urine (treated with sirna 1 (4h)) m/z= 955.74-955.87 F: RT: 5.44 AC M CGC M AApAUp NL: 1.46E5 m/z= 1368.86-1369.22 F: RT: 5.45 AC M CGC M AApAUpGUAUGpUpUpUp NL: 7.25E4 m/z= 1523.94-1524.38 F: RT: 5.46 A*U*AAA *F C *F AUA~CAUUUGCGGU NL: 4.28E5 m/z= 1287.44-1289.45 F: RT: 5.46 AC M CGC M AApAUpGUAUGpUpUp NL: 3.75E5 1 3 5 7 9 11 13 15 17 Time (min) 1523.9650 z=4 AC M CGC M AApAUpGUAUGpUpUp AC M CGC M AApAUp A*U*AAA *F C *F AUA~CAUUUGCGGU 1523.96 1524.22 955.7954 z=3 1218.9713 z=5 1288.4087 z=4 1523.47 1524.47 1524.72 1074.4905 z=3 1388.3894 z=4 1455.4159 z=4 2032.2849 1611.2107 1718.2096 z=3 z=3 z=3 1966.8753 2051.6299 z=3 z=4 0 1200 1400 1600 1800 2000 m/z 1523.5 1525.5 m/z
RT: 0.69-12.16 80 60 40 20 0 80 60 40 20 0 80 60 40 20 0 80 60 40 20 0 SM: 9G RT: 2.92 RT: 2.46 RT: 5.76 RT: 5.71 RT: 5.56 1 2 3 4 5 6 7 8 9 10 11 12 Time (min) RT: 9.62 NL: 1.61E4 m/z= 349.50-349.52 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww NL: 8.48E4 m/z= 869.77-869.80 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww NL: 1.09E5 m/z= 809.09-809.12 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww NL: 4.99E4 m/z= 644.57-644.59 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww Zentrum für Präventive Dopingforschung / Institut für Biochemie -200 µl of urine (DEPC treated) Workflow add ethanol load sample column 1 add ethanol SDS- PAGE load sample column 2 wash Hydrolysis with 0.1 M NaOH LC-HRMS elute with water LC-HRMS Relative Abundance
SDS-Page analysis - Denaturing polyacrylamide TBE-Urea Gels (15%) - 5 µl of sample + 5 µl of sample buffer - Heat for 3 min at 70 C - 180 V const, 75 min - Stain with SyBr-Safe - Scan with a Typhoon fluorescence scanner (GE, 488 nm, Filter 520 nm BP 40) Rat #7 Rat #11 4 h 9 h 24 h 33 h 4 h 9 h 24 h 33 h Std.
RT: 0.69-12.16 80 60 40 20 0 80 60 40 20 0 80 60 40 20 0 80 60 40 20 0 SM: 9G RT: 2.92 RT: 2.46 RT: 5.76 RT: 5.71 RT: 5.56 1 2 3 4 5 6 7 8 9 10 11 12 Time (min) RT: 9.62 NL: 1.61E4 m/z= 349.50-349.52 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww NL: 8.48E4 m/z= 869.77-869.80 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww NL: 1.09E5 m/z= 809.09-809.12 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww NL: 4.99E4 m/z= 644.57-644.59 F: FTMS - p ESI Full ms [300.00-2500.00] MS ICIS 130104_Gel1212_RNAseA_ RNA1ww Zentrum für Präventive Dopingforschung / Institut für Biochemie -200 µl of urine (DEPC treated) Workflow add ethanol load sample column 1 add ethanol SDS- PAGE Digest (RNAse T1, A ) LC-HR-MS/MS load sample column 2 Database search wash elute with water Hydrolysis with 0.1 M NaOH LC-HRMS Relative Abundance LC-HRMS
Experimental RNomics Digest (RNAse T1, A ) Digestion conditions: -RNA bands were excised -Cut into small pieces -Digested with RNAse (T1 or A) for 1 h at 37 C -Centrifugation -Supernatant into fresh tube LC-HR-MS/MS Database Search http://ariadne.riken.jp/index.html MS conditions -Full scan analysis in negative mode (Res 70 000 FWHM) -Data dependent MS/MS triggering, if charge state (m/z) is < -1 -File converting Not for modified sirna Identification of anti-myostatin RNA
Validation results: Sense 1 Antisense 1 Specificity No interfering signals (n = 10) Precision (n=6) 20 % 18 % Recovery (n=6) 18 % 17 % Limit of detection ~25 pmol/ml of urine ~25 pmol/ml of urine Linearity y= 0.3655 x-0.1374, R=0.992 y = 0.1264 x+0.0002, R=0.992
Conclusion - Modern doping control analytical assays include GC-MS(/MS), LC-MS(/MS), electrophoretic, immunological, and combined approaches - Comprehensive coverage of doping agents given loopholes still present - State-of-the-art equipment allows today detecting the administration of sirna as one of the prohibited gene doping strategies - Continuous improvement of analytical methods and their implementation in routine doping controls essential