Supplemental figure 1. Dys-regulated signal pathways in MSCs from TN-Tg mice. 965 dys-regulated genes were uploaded to IPA and David bioinformatics esources software. The top 53 and top 11 dys-regulated pathways were identified by IPA (A) and David bioinformatics esources (B) analysis according to P value. The ratio is the number of genes found in our data set divided by the referenced genes in pathways of software data base. Supplemental figure 2. Expression of Notch genes in MSCs of TN-Tg mice via NAseq. mna levels of Notch-related factors in CD45-/Scal1+/CD15+ MSCs from TN-Tg mice and WT littermates by NA-sequencing. Values are means + SD of 3 mice. Supplemental figure 3. Characterization of 3rd passage of bone-derived MSCs. Bone-derived cells from WT mice were cultured in basal medium and passaged 3 times. (A) The expression profile of MSC surface markers was examined by ACS. MSC surface markers are CD45-/Sca1+/CD15+/CD44+/CD31-/CD11b-/CD117-. (B) The differentiation potential to osteoblasts, adipocytes and chondrocytes were examined by culturing cells in the appropriate inducing media for 2-4 weeks. Supplemental figure 4. The effect of long-term DAPT treatment on expression levels of Notch target genes. TN-Tg mice were treated with DAPT or vehicle by daily gavage for 3 months. Total NA was extracted from popliteal lymph nodes and spleens, and expression levels of Notch-related genes were examined by qpc. Values are means and SD of 3 samples. *p<.5 vs vehicle-treated mice. Supplemental figure 5. Characterization of CU colony cells. BM cells from WT mice were used. ed blood cells were lysed first to obtain BM mononuclear cells. Cells were cultured in basal condition for 3 weeks. Low cell density (1E4/1 cm dish)
was used in CU colony assay to generate colony cells (A). High cell density (1E6/ml) was used to generate BM stromal cells (B). Media were changed every 5 days. Primary BM mononuclear cells were isolated freshly from a separate WT mouse (C). Cells were stained with anti-cd45, Scal1 and CD15 antibodies and subjected to ACS analyses. Supplemental figure 6. In vivo bone repair model. Mice received bone scaffold alone (A) or bone scaffold plus WT CU cells (B) were sacrificed 6 weeks post surgery. H&E-stained sections show the bone defect area (black dash line) and newly formed bone (sold black line). The defects that were filled with bone scaffold alone have significantly lesser bone volume compared to those that were filled with bone scaffold plus CU cells (C). N= 5 mice/group. *p<.5 vs no cell group. Supplemental figure 7. The effect of long-term DAPT treatment on morphology of internal organs. WT mice were treated with DAPT or vehicle by daily gavage for 3 months. Internal organs were stained with H&E. epresentative sections were shown. Supplemental figure 8. Thapsigargin reduces Hes1 expression and revises decreased osteoblast differentiation of MSCs in TN-Tg mice. TN-Tg mice and WT littermates were i.p. injected with the new Notch inhibitor Thapsigargin (.4mg/kg/time) or vehicle daily for 4 days. (A) The inhibitory effect of Thapsigargin on Notch activation (Hes1 mna) was confirmed in the popliteal lymph nodes (positive Ctl) and in CD45- MSC-enriched cells by qpc. (B) epresentative photos and # of CU-ALP+ colonies in BM stromal cells from Thapsigargin- or vehicle-treated mice. TN-Tg mice and WT littermates were i.p. injected with Thapsigargin (.4mg/kg/time, 3 time/week) or vehicle for 2 months. (C) The expression levels of Hey1 in CU cells from Thapsigargin- or PBS-treated mice were examined by qpc. *p<.5 vs vehicle-treated mice, #p<.5 vs WT mice. Supplemental figure 9. Activation status of Notch signaling in cells at different 4
confluence. Expression levels of Hes1 and NICD (Notch-2) in C3H1T1/2 cells at different confluence levels were examined by Western blotting using anti-nicd (Notch-2) antibody. Supplemental figure 1. Correlation of gene expression levels in CD45- MSCs from BM and peripheral blood mononuclear cells. CD45- cells were isolated form BM mononuclear cells (BMMCs) and peripheral blood mononuclear cells (PBMCs) of TN-Tg mice and WT littermates. The expression levels of Hes1 and unx2 from BMMCs and paired PBMCs were determined by qpc. Values were calculated based the equation= ½ CT(gene of interest) CT(actin). 41
Supplemental figure 1A Ingenuity Canonical Pathways p-value HG Signaling.676 Acute Myeloid Leukemia Signaling.1 SAPK/JNK Signaling.1148 B Cell eceptor Signaling.263 ole of Osteoblasts, Osteoclasts and Chondrocytes in heumatoid Arthritis.32 Xenobiotic Metabolism Signaling.39 Molecular Mechanisms of Cancer.3236 PI3K/AKT Signaling.3548 p53 Signaling.4365 LPS/IL-1 Mediated Inhibition of X unction.5248 Assembly of NA Polymerase I Complex.6457 Phospholipid Degradation.6761 Insulin eceptor Signaling.6918 Notch Signaling.779 Type II Diabetes Mellitus Signaling.7762 Huntington's Disease Signaling.7762 Glioblastoma Multiforme Signaling.7943 IL-15 Production.8128 CD27 Signaling in Lymphocytes.8128 Pentose and Glucuronate Interconversions.8128 N- B signaling.8511 JAK/Stat Signaling.9333 Histidine Metabolism.1 Pancreatic Adenocarcinoma Signaling.1471 PPAα/Xα Activation.1122 Production of Nitric Oxide and eactive Oxygen Species in Macrophages.1233 49
Continued Supplemental figure 1A Ingenuity Canonical Pathways p-value Acute Phase esponse Signaling.12589 Lymphotoxin β eceptor Signaling.14791 PDG Signaling.15488 G Signaling.16596 Atherosclerosis Signaling.16982 MSP-ON Signaling Pathway.17783 actors Promoting Cardiogenesis in Vertebrates.17783 Glycerophospholipid Metabolism.17783 IL-9 Signaling.18197 Glycolysis/Gluconeogenesis.19498 Human Embryonic Stem Cell Pluripotency.2893 Androgen and Estrogen Metabolism.21878 Leptin Signaling in Obesity.22387 Assembly of NA Polymerase II Complex.2574 Colorectal Cancer Metastasis Signaling.26915 Type I Diabetes Mellitus Signaling.27542 GM-CS Signaling.28184 Estrogen eceptor Signaling.32359 Chronic Myeloid Leukemia Signaling.33113 Glioma Signaling.37154 PKCθ Signaling in T Lymphocytes.3819 Prostate Cancer Signaling.3819 Tyrosine Metabolism.3819 Docosahexaenoic Acid (DHA) Signaling.3819 Thrombopoietin Signaling.3895 PX/X Activation.42658 Glucocorticoid eceptor Signaling.44668 5
Supplemental figure 1B Supplemental figure 1. Dys-regulated signal pathways in MSCs from TN-Tg mice 51
Supplemental figure 2 35 3 eceptors (PKM) Ligands and co-activators (PKM) 2 25 2 15 16 12 WT TN-Tg 1 8 5 Notch 1 Notch 2 Notch 3 Notch 4 4 Jag1 Delta1 Jag2 Delta4 Dtx1 Dtx2 Dtx3 Dtx4 4 35 3 25 2 15 1 5 Ligands Targets and inhibitors (PKM) 12 1 8 6 4 2 Hes 6 Hes1 Hey1 Hey2 Target genes Co-activators Numb Numbl Inhibitors Supplemental figure 2. Expression of Notch genes in MSCs of TN-Tg mice via NAseq. 52
Supplemental figure 3 A 93.63% 73.65% 71.68% Isotype control Specific antibody CD45 Sca1 CD15 9.24% 99.61% 96.3% 97.52% CD44 CD31 CD11b CD117 B Osteoblasts (Alizarin red) Adipocytes (Oil ed) Chondrocytes (Alcian blue) Supplemental figure 3. Characterization of 3rd passage of bone-derived MSCs. 53
Supplemental figure 4 elative expression level to GAPDH Lymph node Spleen.8.4.8.4 Notch1 Notch2 Hey1 1.6 Hey2 Hes1 Hes2 *.8.8.8.8.8.4.4 *.4 *.4.4.8.8.8.8.8.4.4.4.4.4 * Vehicle DAPT Supplemental figure 4. The effect of long-term DAPT treatment on expression levels of Notch target genes. 54
Supplemental figure 5 A CU cells 5.4% 88.7% 88.6% B Bone marrow stromal cells 15.5% 12.7% 6.7% C Primary bone marrow mononuclear cells 5.6% 8.4% 1.9% CD45 Scal1 CD15 Isotype control Specific antibody Supplemental figure 5. Characterization of CU colony cells. 55
Supplemental figure 6 A Bone scaffold -cells B Bone scaffold + cells C New bone area (mm 2 ).5.4.3.2.1 * Bone scaffold cells Bone scaffold + cells Supplemental figure 6. In vivo bone repair model. 56
Supplemental figure 7 Intestine Lung Liver Kidney Vehicle DAPT Supplemental figure 7. The effect of long-term DAPT treatment on morphology of internal organs. 57
Supplemental figure 8 A Lymph nodes Hes1 (fold vs WT veh.) CD45- cells 2.5 2 1.5 1.5 # * # * * * WT TN-Tg WT TN-Tg Vehicle Thapsigargin B Vehicle Thapsigargin WT 6 CU-ALP (#/well) * # 4 TN-Tg 2 WT TN-Tg C Hey1 expression fold change 4 3 2 1 * # * WT TN-Tg Supplemental figure 8. Thapsigargin reduces Hes1 expression and revises decreased osteoblast differentiation of MSCs in TN-Tg mice. 58
Supplemental figure 9 Hes1 NICD GAPDH 5% 8% 1% Confluence Supplemental figure 9. Activation status of Notch signaling in cells at different confluence. 59
Supplemental figure 1.4 Hes1.3.2.1.16.12.8.4 unx2 WT TN-Tg BMMCs WT TN-Tg PBMCs WT TN-Tg WT TN-Tg BMMCs PBMCs Supplemental figure 1. Correlation of gene expression levels in CD45- MSCs from BM and peripheral blood mononuclear cells. 6
Name / Sequences mhes1 GACCCAGATCAACGCCATGA TGGAAGCCGCCAAAAACCTT mhes2 CTGAAGGGTCTCGTATTGCCG CGCAGGTGCTCTAGTAGGC mhey1 GCGCGGACGAGAATGGAAA TCAGGTGATCCACAGTCATCTG mhey2 AAGCGCCCTTGTGAGGAAAC GGTAGTTGTCGGTGAATTGGAC mnotch1 CCCTTGCTCTGCCTAACGC GGAGTCCTGGCATCGTTGG mnotch2 ATGTGGACGAGTGTCTGTTGC GGAAGCATAGGCACAGTCATC malp CTTGCTGGTGGAAGGAGGCAGG CACGTCTTCTCCACCGTGGGTC munx2 CAAGAAGGCTCTGGCGTTTA TGCAGCCTTAAATGACTCGG mgapdh GGTCGGTGTGAACGGATTTG ATGAGCCCTTCCACAATG Supplemental table A. Murine primer sequences 61
B. Human primer sequences Name hhes1 / Sequences TGAGCCAGCTGAAAACACTG GTGCGCACCTCGGTATTAAC hhey1 GTTCGGCTCTAGGTTCCATGT CGTCGGCGCTTCTCAATTATTC hp52 ATGGAGAGTTGCTACAACCCA CTGTTCCACGATCACCAGGTA helb CCATTGAGCGGAAGATTCAACT CTGCTGGTCCCGATATGAGG halp ACCACCACGAGAGTGAACCA CGTTGTCTGAGTACCAGTCCC hunx2 TCAACGATCTGAGATTTGTGGG GGTCAAGGTGAAACTCTTGCC hgapdh AAGGTGAAGGTCGGAGTCAAC GGGGTCATTGATGGCAACAATA 62