Technical University of Munich Chair for Biofunctionality Gut microbiology PRACTICAL COURSE 2011 Dr. Thomas Clavel
Table of content 1 Introduction 2 Culture-based approaches 3 16S rrna 4 Sequencing 5 Gut microbiota in IBD
MICROBIOLOGY: Study of microscopic organisms - Bacteria (BACTERIOLOGY) - Fungi (including yeasts) - Protozoa - Viruses CELLULAR MICROBIOLOGY Metabolism; Biochemistry SYSTEMATICS Classification; e.g., Akkermansia muciniphila CIP 107961 T MOLECULAR MICROBIOLOGY Phylogeny; Genomics MICROBIAL ECOLOGY Interactions
Role of bacteria in IBD 1 + 2 Fecal stream diversion (Rutgeerts et al., 1991) Onderdonk et al., 1981
Diversity and distribution of intestinal microbiota Stomach Small intestine Large intestine (colon) Stomach (10 1-10 3 CFU g -1 ) Helicobacter; Lactobacillus; Streptococcus Ileum (10 7-10 8 CFU g -1 ) Enterobacteriaceae; Lactobacillus; Streptococcus Colon (10 11-10 13 CFU g -1 ); > 1 000 species Alistipes; Bacillus; Bacteroides; Bifidobacterium; Collinsella; Clostridium; Dorea; Enterococcus; Eubacterium; Faecalibacterium; Parabacteroides; Roseburia; Ruminococcus; Streptococcus
Culture-dependent analysis of bacterial diversity Complex ecosystem Plating of serial dilutions Anaerobic box N 2 + CO 2 + H 2 Rich or selective agar Growth Various colonies Counting and phenotyping
Culture-dependent analysis of bacterial diversity - Morphology - - Growth characteristics - -Enzymatic tests - - SCFA - -Antibiotic resistance - -Sporulation - - Motility - -Cell wall structure - - CFA / quinones / polar lipids -
0.1 Olsenella 0.1 Isolation and characterization of bacteria do03 equoli obob2aaa03g05 Clone obob2_aaa03g05 (EF096493) Uncultured Clone H75N2_66f08 (EU453459) B7 Enterorhabdus caecimuris DSM 21839 T (DQ789120) sinensishku14 NPOH1 Slackia Coriobacterium SWPT5aaa04e11 Clone SWPT5_aaa04e11 (EF100091) mucosicola Enterorhabdus mucosicola DSM 19490 T (AM747811) C16E16 Clone C16_E16 (AY992290) SWPT12aaa04f04 Clone SWPT12_aaa04f04 (EF098044) M3f063 Clone M3_f06_3 (DQ015649) RL176aah44c05 Clone RL176_aah44c05 (DQ793846) Asaccharobacter celatus DSM 18785 T (AB266102) Adlercreutzia equolifaciens DSM 19450 T (AB306661) Julong732 Human intestinal bacterium SNU-Julong732 (AY310748) lentam2 Eggerthella lenta DSM 2243 T (AF292375) Eggerthella sinensis DSM 16107 T (AY321958) HKU Paraeggerthella hongkongensis DSM 16106 T (AY288517) Gordonibacter pamelaeae 7-10-1-b T (AM886059) Denitrobacterium detoxificans CCUG 56741 T (U43492) Slackia exigua ATCC 700122 T (AF101240) isoflavoniconvertens Slackia isoflavoniconvertens DSM 22006 T (EU826403) Cryptobacterium curtum DSM 15641 T (AB019260) Eubacterium Collinsella aerofaciens DSM 3979 T (AB011816) Coriobacterium glomerans DSM 20642 T (X79048) A.minutum Atopobium minutum DSM 20586 T (X67148) Olsenella uli DSM 7084 T (AF292373) Eubacterium limosum DSM 20543 T (M59120) limo Strain Mt1B8 10 µm Clavel et al., IJSEM, 2009
Isoflavone conversion by strain Mt1-B8 Matthies et al., AEM, 2008
Gnotobiology Germfree environment
Simulator of the Gastrointestinal Microbial Ecosystem
The 16S ribosomal RNA Noller and Woese, 1981, Science 212 30S 50S 16S 5S + 23S Conserved Variable Highly variable 5 3 - Specific structure - Ubiquitous and abundant
Clone libraries 1 Complex ecosystem DNA extraction DNA mixture Specific PCR 1 500 bp Numerous copies of different 16S rdna amplicons lacz Ligation Transformation Sequencing Lactose- and Antibioticcontaining medium 5 ACGTAGCTAGCCCATGCGGTTTTACGC ATCACTACGAGGTTTTTGCGTACGTAGC ATCGACGGGCATGCATGCTGACTGCGTC TACGTAGCTAG Alignment Similarity % Suau et al., AEM, 1999
Sanger sequencing
High-throughput sequencing Roche (454) Illumina SOLiD Chemie Pyrosequenzierung Polymerase-basiert Ligations-basiert Amplifikation Emulsions PCR Brücken Amplifikation Mb/Lauf 100 Mb 1300 Mb Emulsions PCR 3000 Mb Zeit/Lauf 7 h 4 Tage 5 Tage Länge der reads 250-500 bp 32-40 bp 35 bp Kosten pro Lauf (gesamt) $ 8 439 $ 8 950 $ 17 447 Kosten pro Mb $ 84,4 $ 5,97 $ 5,81
Genome sequencer FLX (454 pyrosequencing) 1 16S-specific PCR A B 2 empcr
Genome sequencer FLX (454 pyrosequencing)
Pyrosequencing adenosine 5 -phosphosulfate luciferin oxy-luciferin + light!!!
Functional metagenomic Assessment of the intestinal microbiome (3 10 6 genes) 1 Density gradient Cell lysis 40,000 bp Complex ecosystem Bacteria Size exclusion DNA Screening of activities E. coli Cloning 25,000 Fosmid
The core microbiome http://commonfund.nih.gov/hmp http://www.metahit.eu Qin et al., Nature, 2010
Gut microbiota in IBD Loss of Firmicutes in IBD (Manichanh et al., Gut, 2006) (Peterson et al., 2008) (Sokol et al., PNAS, 2008)
Gut microbiota in IBD Fluorescence in situ hybridization Higher density of mucosa -associated bacteria in IBD (Swidsinski et al., 2005) Adherent-invasive E. coli (AIEC) (Darfeuille-Michaud et al., Gastroenterol 1998)
Bacteriophages in the gut Reyes et al., Nature, 2010
Bacteriophages in IBD (n = 14) (n = 19) 100 nm Lepage et al., Gut, 2008
Culture (Large-scale) selective isolation and characterization of (novel) bacteria Molecular HTS and screening approaches to identify (novel) bacterial signals associated with diseases Host-Bacteria Relevance of selected bacteria or products thereof