Complex Cyclin Cyclin- Dependent rotein Kinase Function promotes passage through restriction G1-CDK Complex Cyclin D CDK4 or CDK6 point in late G1 G1/S-CDK Complex Cyclin E CDK2 commits the cell to DA replication at the end of G1 S-CDK Complex Cyclin A CDK2 required for the initiation of DA replication M-CDK Complex Cyclin B CDK1 promotes the events of mitosis
C G T A H H H H H H Cyclin + 15 160 Cyclin 15 160 Accessory roteins Cyclin Cyclin 15 160 15 160 rigin of Replication (ri) Initiation Factors Replication Fork
Helicases Single Strand DA Binding roteins Topoisomerases DA Directed RA olymerase - rimase DA Directed DA olymerase Leading Strand Lagging Strand 3 3 5 Lagging Strand Leading Strand Leading Strand Lagging Strand 3 3 5 Lagging Strand Leading Strand rigin of Replication
Subunit Activity 2 α (alpha) polymerase activity 2 ε (epsilon) 3 exonuclease, the proof reading activity 2 θ (theta) function not precisely known, may be involved in α, ε assembly / scaffold protein 4 β (beta) forms sliding clamp holding enzyme to DA 2 τ (tau) assembly of holoenzyme on DA 2 γ (gamma) part of the gamma complex 1 δ (delta) part of the gamma complex 1 δ (delta prime) part of the gamma complex 1 χ (chi) part of the gamma complex 1 ψ (psi) part of the gamma complex
DA olymerase I 3 RA rimer Leading Strand Lagging Strand 3 Exonuclease Activity (rimer Removal) olymerase Activity 3 Exonuclease Activity (roofreading) 3 Leading Strand (Counterclockwise) TerG Clockwise Trap TerF TerB TerC To ri TerA TerD Counterclockwise Trap TerB 3 Leading Strand (Clockwise)
ol δ Replicator Cdt1 Cdc6 Cdc45 Cdt1 Cdc6 Cdc45 Cdc45 ol α Cdc45 ol α ol α Cdc45 ol δ CA ol α Cdc45 ol δ ol ol ol ol ol ol ol CA ol ol ol ol ol Rase H1 ol ol ol ol FE1/RTH1 ol ol ol ol DA Ligase ol ol ol ol TEL 3 Telomerase binds to the 3 end of the singlestranded region, and the RA template forms base pairs with the chromosomal DA. CUAACCCUAAC AACCCTAACCCTAA 3 ATTGGGATTGGGATTGGGATTGGGATT TEL 3 An additional repeat is added to the 3 end of the DA using the internal RA as a template. CUAACCCUAAC AACCCTAACCCTAA 3 ATTGGGATTGGGATTGGGATTGGGATTGGGATT TEL 3 Telomerase shifts by six nucleotides and is positioned to synthesize another repeat. CUAACCCUAAC AACCCTAACCCTAA 3 ATTGGGATTGGGATTGGGATTGGGATTGGGATT
Correlation (Equivalency) Table for Replication Bacteria Eukaryotes Function DnaA rigin Recognition Complex 1-6 Recognizes and binds to the rigin of Replication or the (RC1 - RC6) Replicator Sequence. DnaB MCM Complex Helicase Activity DnaC Cell-division-cycle rotein 6 (Cdc6) Loads the Helicase into the Initiation Complex SSB Replication Licensing Factor (Cdt1) Replication Factor A () Single Strand Binding rotein rimase DA olymerase α Synthesizes RA primer DA olymerase III α, ε, & θ subunits DA olymerase III β subunits DA olymerase III δ, δ, χ & ψ subunits DA olymerase I 3 exonuclease DA olymerase I α, ε, & θ subunits DA olymerase I β subunits DA olymerase I δ, δ, χ & ψ subunits DA olymerase δ DA olymerase ε roliferating Cell uclear Antigen (CA) Replication Factor C () Rase H1 FE1/RTH1 DA olymerase ε roliferating Cell uclear Antigen (CA) Replication Factor C () The polymerase and the 3 exonuclease (proofreading) activities The sliding clamp that tethers the enzyme to the DA Clamp loading complex Removes the RA primers The polymerase and the 3 exonuclease (proofreading) activities The sliding clamp that tethers the enzyme to the DA Clamp loading complex DA Ligase DA Ligase Seals nicks between kasaki fragments How DA Is Damaged During Replication - Transitions or Transversions Deamination - A, C, or G Ionizing Radiation Base Alkylation Intercalating Agents H Z H S S S H 2 H 2 H H
(E 6 Homologs) MutS (E 5 Homologs) MutL