From Gene to Protein How Genes Work 2007-2008
Wht do genes code for? How does DNA code for cells & bodies? how re cells nd bodies mde from the instructions in DNA DNA proteins cells bodies
The Centrl Dogm Flow of genetic informtion in cell How do we move informtion from DNA to proteins? DNA RNA protein trit repliction DNA gets ll the glory, but proteins do ll the work!
Metbolism tught us bout genes Inheritnce of metbolic diseses suggested tht genes coded for enzymes ech disese (phenotype) is cused by non-functionl gene product lck of n enzyme Ty schs PKU (phenylketonuri) lbinism Am I just the sum of my proteins? metbolic pthwy disese disese disese disese A B C D E enzyme 1 enzyme 2 enzyme 3 enzyme 4
Bedle & Ttum 1941 1958 one gene : one enzyme hypothesis George Bedle Edwrd Ttum "for their discovery tht genes ct by regulting definite chemicl events"
Bedle & Ttum Wild-type Neurospor X rys or ultrviolet light crete muttions Miniml medium spores sexul spores Growth on complete medium positive control Select one of the spores Test on miniml medium to confirm presence of muttion negtive control Grow on complete medium Miniml medi supplemented only with experimentls Pyridoxine Choline mino cid p-amino Inositol supplements benzoic cid Nucleic cid Folic cid Arginine Riboflvin Nicin Thimine Miniml control
From gene to protein DNA trnscription nucleus cytoplsm mrna trnsltion ribosome protein trit
Trnscription from DNA nucleic cid lnguge to RNA nucleic cid lnguge 2007-2008
RNA ribose sugr N-bses urcil insted of thymine U : A C : G single strnded lots of RNAs mrna, trna, rrna, sirna DNA trnscription RNA
Trnscription Mking mrna trnscribed DNA strnd = templte strnd untrnscribed DNA strnd = coding strnd sme sequence s RNA synthesis of complementry RNA strnd trnscription bubble enzyme RNA polymerse coding strnd 5 DNA C G 3 A G A T T C T A rewinding G C T A G G C C C G A A T T U A C C G G G C T U A A 3 T T A C G A C T A G T A T unwinding 3 5 build RNA 5 3 mrna 5 RNA polymerse templte strnd
RNA polymerses 3 RNA polymerse enzymes RNA polymerse 1 only trnscribes rrna genes mkes ribosomes RNA polymerse 2 trnscribes genes into mrna RNA polymerse 3 only trnscribes trna genes ech hs specific promoter sequence it recognizes
Which gene is red? Promoter region binding site before beginning of gene TATA box binding site binding site for RNA polymerse & trnscription fctors Enhncer region binding site fr upstrem of gene turns trnscription on HIGH
Trnscription Fctors Initition complex trnscription fctors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off trnscription trigger the binding of RNA polymerse to DNA
Mtching bses of DNA & RNA Mtch RNA bses to DNA bses on one of the DNA strnds U G U C C G A A U A G A C U 5' A 3' RNA A C C G polymerse G C A G U A U C T G G T A C A G C T A G T C A T C G T A C C G T
Eukryotic genes hve junk! Eukryotic genes re not continuous exons = the rel gene expressed / coding DNA introns = the junk inbetween sequence introns come out! eukryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence
mrna splicing Post-trnscriptionl processing eukryotic mrna needs work fter trnscription primry trnscript = pre-mrna mrna splicing edit out introns mke mture mrna trnscript eukryotic DNA intron = noncoding (inbetween) sequence ~10,000 bse primry mrna trnscript mture mrna trnscript exon = coding (expressed) sequence pre-mrna spliced mrna ~1,000 bse
Discovery of exons/introns 1977 1993 Richrd Roberts CSHL Philip Shrp MIT denovirus common cold bet-thlssemi
Splicing must be ccurte No room for mistkes! single bse dded or lost throws off the reding frme AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG CGG UCC GAU AAG GGC CAU Met Arg Ser Asp Lys Gly His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG CGG GUC CGA UAA GGG CCA U Met Arg Vl Arg STOP
RNA splicing enzymes snrnps smll nucler RNA proteins Spliceosome severl snrnps recognize splice site sequence cut & pste gene No, not smurfs! snurps exon snrna intron snrnps exon 5' 3' 5' 5' Who! I think we just broke biologicl rule! spliceosome 3' lrit 3' exon mture mrna 5' exon 3' excised intron
Alterntive splicing Alterntive mrnas produced from sme gene when is n intron not n intron different segments treted s exons Strting to get hrd to define gene!
More post-trnscriptionl processing Need to protect mrna on its trip from nucleus to cytoplsm enzymes in cytoplsm ttck mrna protect the ends of the molecule dd 5 GTP cp dd poly-a til longer til, mrna lsts longer: produces more protein 3' mrna A 5' G P P P
From gene to protein DNA trnscription nucleus cytoplsm mrna trnsltion ribosome protein trit
Trnsltion from nucleic cid lnguge to mino cid lnguge 2007-2008
How does mrna code for proteins? 4 DNA mrna 4 protein 20 ATCG AUCG TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC? Met Arg Vl Asn Al Cys Al How cn you code for 20 mino cids with only 4 nucleotide bses (A,U,G,C)?
mrna codes for proteins in triplets DNA mrna TACGCACATTTACGTACGCGG codon AUGCGUGUAAAUGCAUGCGCC? protein Met Arg Vl Asn Al Cys Al
Crcking the code Crick 1960 1968 Nirenberg & Khorn determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorn (17) determined mrna mino cid mtch dded fbricted mrna to test tube of ribosomes, trna & mino cids creted rtificil UUUUU mrna found tht UUU coded for phenyllnine
Mrshll Nirenberg 1960 1968 Hr Khorn
The code Code for ALL life! strongest support for common origin for ll life Code is redundnt Why is the wobble good? severl codons for ech mino cid 3rd bse wobble Strt codon AUG methionine Stop codons UGA, UAA, UAG
How re the codons mtched to mino cids? DNA mrna trna mino cid 3 5 3 TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC UAC Met 5 GCA Arg CAU Vl codon nti-codon 5 3
From gene to protein DNA trnscription nucleus cytoplsm mrna trnsltion ribosome protein trit
Trnsfer RNA structure Clover lef structure nticodon on clover lef end mino cid ttched on 3 end
Loding trna Aminocyl trna synthetse enzyme which bonds mino cid to trna bond requires energy ATP AMP bond is unstble so it cn relese mino cid t ribosome esily ctivting enzyme Trp C=O Trp C=O Trp OH H 2 O OH O O trna Trp nticodon tryptophn ttched to trna Trp A C C U G G mrna trna Trp binds to UGG condon of mrna
Ribosomes Fcilitte coupling of trna nticodon to mrna codon orgnelle or enzyme? Structure ribosoml RNA (rrna) & proteins 2 subunits lrge smll E P A
Ribosomes A site (minocyl-trna site) holds trna crrying next mino cid to be dded to chin P site (peptidyl-trna site) holds trna crrying growing polypeptide chin E site (exit site) empty trna leves ribosome from exit site 5' E U A C A U G P Met A 3'
Building polypeptide Initition brings together mrna, ribosome subunits, inititor trna Elongtion dding mino cids bsed on codon sequence Termintion end codon 3 2 1 Met Leu Met Met Met Leu Leu Leu Vl Ser Al Trp relese fctor trna UAC GAC 5' UAC 5' UACGAC AA C AAU 5' AUG C UGAAU 5' mrna A UG C UG U AUG UG 3' 3' 3' E P A UAC GAC C AA U AUG UG 3' A CC U GG UA A 3'
Protein trgeting Signl peptide ddress lbel strt of secretory pthwy Destintions: secretion nucleus mitochondri chloroplsts cell membrne cytoplsm etc
DNA RNA polymerse Cn you tell the story? pre-mrna exon intron 5' GTP cp mino cids trna lrge ribosoml subunit mture mrna poly-a til polypeptide minocyl trna synthetse 3' 5' smll ribosoml subunit E P A trna ribosome
The Trnscriptionl unit (gene?) enhncer 1000 + b 20-30b trnsltion strt exons trnsltion stop 3' RNA polymerse TATA TAC trnscriptionl unit (gene) ACT 5' DNA DNA UTR introns UTR promoter trnscription strt trnscription stop 5' 3' pre-mrna 5' 3' GTP mture mrna AAAAAAAA
Bcteril chromosome Protein Synthesis in Prokryotes Trnscription mrna Psssst no nucleus! Cell membrne Cell wll 2007-2008
Prokryote vs. Eukryote genes Prokryotes DNA in cytoplsm circulr chromosome nked DNA no introns Eukryotes DNA in nucleus liner chromosomes DNA wound on histone proteins introns vs. exons eukryotic DNA intron = noncoding (inbetween) sequence exon = coding (expressed) sequence introns come out!
Trnsltion in Prokryotes Trnscription & trnsltion re simultneous in bcteri DNA is in cytoplsm no mrna editing ribosomes red mrna s it is being trnscribed
Trnsltion: prokryotes vs. eukryotes Differences between prokryotes & eukryotes time & physicl seprtion between processes tkes eukryote ~1 hour from DNA to protein no RNA processing
Any Questions?? Wht color would smurf turn if he held his breth? 2007-2008
Substitute Slides for Student Print version 2007-2008
Cn you tell the story?
The Trnscriptionl unit enhncer 1000 + b 20-30b exons 3' RNA polymerse TATA TAC trnscriptionl unit ACT 5' DNA introns 5' 3' 5' 3'