Chicken EpithelialGut CellLines 1

Similar documents
A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

INTESTINAL ORGANOIDS. IntestiCult and STEMdiff Media for Intestinal Organoid Culture. Scientists Helping Scientists

Product Datasheet. Cytokeratin 8 Antibody (OTI1B12) NBP Unit Size: 0.1 ml. Store at -20C. Avoid freeze-thaw cycles.

NaNoplasmid TM. Platform SIZE MATTERS SMALLER IS BETTER

Transient production of recombinant proteins using the MEXi system

OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes

Your Power for Health. Magnetic cell culturing. The n3d approach

Dr: RAWIA BADR Associate Professor of Microbiology&Immunology

Elwyn Griffiths, DSc, PhD, UK

Supplementary Fig. 1. Schematic structure of TRAIP and RAP80. The prey line below TRAIP indicates bait and the two lines above RAP80 highlight the

Molecular & Virology Services

Supplementary Table, Figures and Videos

SUPPLEMENTARY INFORMATION

PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence

Lullaby sirna Transfection Reagent - Results

WST-1 CTLL-2 cell proliferation Kit (ready-to-use)

COMMITTEE FOR VETERINARY MEDICINAL PRODUCTS NOTE FOR GUIDANCE 1 : DNA VACCINES NON-AMPLIFIABLE IN EUKARYOTIC CELLS FOR VETERINARY USE

gacgacgaggagaccaccgctttg aggcacattgaaggtctcaaacatg

Contents. The Right Surface for Every Cell Extracellular Matrices and Biologically Coated Surfaces ECM Mimetic and Advanced Surfaces...

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated

Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins

RECENT IMPROVEMENTS TO LONZA S GLUTAMINE SYNTHETASE (GS) GENE EXPRESSION SYSTEM. Dr Robert Gay

Cells Culture Techniques Marta Czernik

TRANSFEX - SUPERIOR GENE EXPRESSION FOR HARD-TO-TRANSFECT CELL TYPES. Kevin Grady Product Line Business Manager ASCB Vendor Showcase Dec.

Antibodies against PCNA were previously described [1]. To deplete PCNA from Xenopus egg

Product Data Sheet - TRUEMAB

Supplementary information

Bcl-2 family member Bcl-G is not a pro-apoptotic BH3-only protein

Yeast Nuclei Isolation Kit

BIOPHARMACEUTICAL PROCESS EVALUATED FOR VIRAL CLEARANCE

Biomimetic Tri-Culture Models to Study Gut Microbiota- Epithelial-Immune Interactions In Vitro

Integrated Protein Services

The Vaxonella Platform for Oral Recombinant Vaccine Delivery

FectoCHO Expression system DNA transfection kit for protein production PROTOCOL

The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.

TransIT-PRO Transfection Reagent Protocol for MIR 5740 and 5750

Respiratory (tract) cell line

FectoPRO DNA transfection kit for Bioproduction PROTOCOL

The Molecular Virology Support Core: Adenoviral Vectors and Beyond

Figure S1. Sequence alignments of ATRIP and ATR TopBP1 interacting regions.

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

fibrils, however, oligomeric structures and amorphous protein aggregates were

Supervisor:Dr.M.Aslanimehr Presented by :M.Marandi

Develop Better Assays for Every Human Protein

APPROACHES TO IMPROVING THE PERFORMANCE OF MAMMALIAN CELL CULTURES FOR PROTEIN PRODUCTION

Nature Medicine: doi: /nm.4464

Li et al., Supplemental Figures

Product Data Sheet - TRUEMAB

SUMOstar Gene Fusion Technology

CHOgro Expression System

Supplementary Materials

OPPF-UK Standard Protocols: Mammalian Expression

Arrest-In Transfection Reagent Catalog numbers: ATR1740, ATR1741, ATR1742, ATR1743

SUPPLEMENTARY INFORMATION

Executing T-REX in mammalian cells

Post-translational modification

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

K2 Transfection System

Transcription Factor Runx3 Is Induced by Influenza A Virus and Double-Strand RNA and

Supplementary Figure 1. α-synuclein is truncated in PD and LBD brains. Nature Structural & Molecular Biology: doi: /nsmb.

INTEGRATED PROTEIN SERVICES

Nature Medicine doi: /nm.3554

ProteoGenix. Life Sciences Services and Products. From gene to biotherapeutics Target Validation to Lead optimisation

Vivapure AdenoPACK 20

Instructions. Torpedo sirna. Additional Material Required. Overview. Important Guidelines. Specifications. Shipping and Storage.

SUPPLEMENTARY INFORMATION

Product Data Sheet - TRUEMAB

INVESTIGATION OF THE BINDING SPECIFICITY OF IGF-IR USING MONOCLONAL ANTIBODIES

INOS. Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG00807

Loss of Cul3 in Primary Fibroblasts

Figure S1. Optimization of reverse-transfection protocols using GAPDH sirnas. MDA- MB-231 cells were seeded in 96-well plates at a density of 5000

Supplementary Figure 1. Intracellular distribution of the EPE peptide. HeLa cells were serum-starved (16 h, 0.1%), and treated with EPE peptide,

Biosafety Level Host Range Propagation Comments

CytoGLOW. IKK-α/β. Colorimetric Cell-Based ELISA Kit. Catalog #: CB5358

5.14. GENE TRANSFER MEDICINAL PRODUCTS FOR HUMAN USE. Recombinant vectors Gene transfer medicinal products for human use

Supplemental Figure 1

Contact Person: Fax: IACUC Protocol Title: Address: Department: Yes. Primers Name: Concentration: Fragment Size:

PLA2 domain in parvoviruses The enzymatic features of viral PLA2

Virus- infectious particle consisting of nucleic acid packaged in a protein coat.

VEGFR2 (Phospho-Tyr1175)

TransIT-PRO Transfection Kit Protocol for MIR 5700 and 5760

Multi-Purpose Transfection Reagents

SUPPLEMENTARY INFORMATION

Inducible Protein Expression in LEXSY with Monitoring Induction

The Biotechnology Toolbox

Technical tips Session 4

NS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5

TransIT -LT1 Transfection Reagent

Product Datasheet. ELK3 Antibody (OTI1H3) NBP Unit Size: 0.1 ml. Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 1

Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology

1. Immunization. What is Immunization? 12/9/2016. Chapter 17: Immunization & Immune Testing. 1. Immunization 2. Diagnostic Immunology

It s All in the Hands Genetic Engineering

Androgen Receptor (Phospho-Tyr363) Colorimetric Cell-Based ELISA Kit. Catalog #: OKAG02138

Salmonella Antigen Detection (In Food)

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications

Illumatool ΤΜ Tunable Light System: A Non-Destructive Light Source For Molecular And Cellular Biology Applications. John Fox, Lightools Research.

Supplementary Materials for

Transcription:

Chicken EpithelialGut CellLines 1

Content 01 Introduction p 3 02 Characterization p 5 03 Infection and inhibition p 6 04 Protein expression system p 8 05 NutriProof p 10 06 Contact p 12

01...which came first, the chicken or the egg? But seriously, with the primary goal to analyze infection processes in the avian gut system, we decided to generate chicken enterocyte cell lines. Using eggs from specific pathogen-free white Leghorn hens as a source we isolated cells out of the guts (intestine and caecum) of 18- day old embryonic chicken and subjected them to a specialized procedure of plating, growth factor treatment and genetic transformation. Step I Step II Step III Figure 1: Generation process of epithelial chicken gut cell lines from egg to characterized cell clones. In the end we succeeded in isolating more than 240 individual continuously growing epithelial clones representing as judged by eye - at least 5 different epithelial morphotypes. According to their growth characteristics, 12 of these clones were subjected to further studies. The avian origin as well as the epithelial phenotype could be confirmed by the use of marker-specific antibodies. Altogether, we present here the largest collection of chicken epithelial gut cell lines worldwide. 3

Figure 2: Chicken cell line 9E6 was stained with cadherin (green). The nucleus was stained with DAPI (blue). 4

02 Characterization Cells were characterized with different markers for intestinal epithelium by Western Blot or immunofluorescence (Fig. 2). The chicken origin was confirmed with chicken MHC I antibodies and the karyogram of the cells. Furthermore, the physiological function of chicken cells was checked by interleukin 6 and 8 expression upon stimulation(tab. 1). Characterization by expression Characterization by function cell clone Villin E-cadherin Cytokeratin LPS stimulation Campylobacter infection 8E11 X X X 9E6 X X X 2G4 X X X 10F6 X X X Inductionof IL6 + IL8 (K60) Inductionof IL6 + IL8 (K60) Inductionof IL6 + IL8 (K60) Inductionof IL6 + IL8 (K60) Invasive Highly invasive Invasive Invasive 10B3 X X X u.i.* u.i.* 8E8 X X u.i.* u.i.* u.i.* 9E5 X X u.i.* u.i.* u.i.* 5F6 X X X u.i.* u.i.* 6D2 X u.i.* u.i.* u.i.* u.i.* 9E7 X u.i.* X u.i.* u.i.* 8G8 X X X u.i.* Invasive 6E4 X X X u.i.* u.i.* Table 1: Overview of the characterization of different chicken cell lines. *under investigation 5

03 Infection and inhibition A subset of the established chicken gut cell lines has been tested according to its susceptibility (adhesiveness and invasiveness) to various Campylobacter and Salmonella strains. As figures 3-5 illustrate, Campylobacter and Salmonella strains exhibited a distinct potential to infect chicken gut cells. cfu/ml adenocarcinoma cell line Caco-2, which still serves as the most commonly used epithelial gut cell model. 8,00E+05 7,00E+05 6,00E+05 5,00E+05 4,00E+05 3,00E+05 Comparison of chicken gut cell line 8E11 and human Caco-2 cells according to their adhesiveness to Campylobacter jejuni strain 11168 cfu/ml 7,00E+05 6,00E+05 5,00E+05 4,00E+05 3,00E+05 2,00E+05 1,00E+05 Comparison of chicken gut cell line 8E11 and human Caco-2 cells according to their susceptibility to Salmonella typhimurium Chicken Caco-2 2,00E+05 1,00E+05 0,00E+00 1 3 5 Time of infection (h) Figure 4: Campylobacter(C. jejuni strain 11168) showed stronger adhesiveness to chicken 8E11 cells compared to human Caco-2 cells. 7,00E+04 6,00E+04 Comparison of chicken gut cell line 8E11 and human Caco-2 cells according to their invasiveness to Campylobacter jejuni strain 11168 0,00E+00 3h S. Typhimurium Figure 3: Chicken 8E11 cells showed a higher susceptibility to S. typhimurium compared to human Caco-2 cells (cfu = colony forming units). 6h cfu/ml 5,00E+04 4,00E+04 3,00E+04 Both, Campylobacter jejuni and Salmonella enterica showed higher invasiveness for chicken cells compared to the human colorectal 2,00E+04 1,00E+04 0,00E+00 1 3 5 Time of infection (h) Figure 5: Campylobacter(C. jejuni strain 11168) showed stronger invasiveness for chicken 8E11 cells compared to human Caco-2 cells. 6

Using this platform, a powerful in vitro model for the analysis of Campylobacter and Salmonella infection processes was established. This model is also applicable to evaluate novel inhibitors of infection, as we demonstrated with carvacrol, known as an inhibitor of bacterial infection processes. In this context, MicroMol offers its experience to analyze food additives and other substances according to their inhibitory potential. Relying on our expertise, it is also possible to adopt the system onto further infection systems according to clients demands. Inhibition of Campylobacter infection (C. jejuni strain 81-176) with Carvacrol Percentage of inhibition compared to control 140 120 100 80 60 40 20 control 0.1 mm 0.05 mm 0 Adhesion Invasion Figure 6: Carvacrol inhibited the adhesion and invasion of C. jejuni strain 81-176 on chicken 8E11 cells. 7 Figure 7: The chicken cell line 8E11 was infected with Salmonella for 3 h. Salmonella is stained green. The cells were stained with cadherin (red) and the nuclei with DAPI (blue).

04 A novel protein expression system The remarkable expression level upon transfection, the specific pathogen-free origin and cryopreservation in early passages are attributes that qualify chicken cell clone 8E11 as an optimal means for expression of recombinant proteins. Experiments performed in the MicroMol laboratory indicate that expression levels are comparable - and in certain cases even higher - than that of the typical standard cell lines (HEK 293, HEK 293T, CHO- K1) used for recombinant protein production. In addition, the chicken clone 8E11 can be used for the propagation of defined virus strains using the avian environment for replication. Recombinant proteins can be produced in chicken cell line 8E11 upon transfection. The indicated cell lines were transfected with cdnas coding for a recombinant murine antibody. After 24 hours, supernatants were subjected to Protein G purification. Eluates thereof were analyzed by SDS-PAGE/ Western Blot (Fig. 8). Transfection of WT1 HEK HEK Chicken CHO 293T 293 8E11 K1 Figure 8: Western Blot analysis of WT1 protein expressed in standard expression cell lines and chicken clone 8E11. Furthermore, an expression vector coding for the human WT1 protein was transfected in the indicated standard expression cell lines as well as in the chicken clone 8E11. After 24 hours cells were harvested, lysates were prepared and aliquots derived thereof were analyzed by SDS-PAGE/ Western Blot (Fig. 9). Transfection of hqbeta3 HEK HEK CHO Chicken 293T 293 K1 8E11 Figure 9: Western Blot analysis of hqbeta3 protein expressed in standard expression cell lines and chicken clone 8E11. 8

Features: Expression in a eukaryotic cell system derived from embryonic tissue of specific pathogen-free(spa) origin Expression in cell clones available in early passages Cells easy to expand to high cell numbers Easy transfection with various protocols and systems High expression levels comparable or even better than standard models HEK293 and CHO-K1 9 Figure 10: Comparative Western Blot analysis between chicken gut cell line (clone 8E11) and HEK 293, HEK293T and CHO K1.

05 Further A novel Applications testing system - Protein NutriProof Expression Using the term NutriProof, we combine a series of cell-based assays with the potential to analyze and determine positive and negative effects of food formulations, additives, chemicals and substances used by the feed and poultry industry on a fast and significant primary screening platform. The great advantage of this concept is ability to use a functional active chicken enterocyte cell line as the target for these evaluations. With the first test of this kind NutriTox - we are able to determine or exclude potential toxic effects of food formulations and compounds on the cellular level (Tab. 2). The NutriTox assay was evaluated strictly according to the demands of the DIN ISO 10993-5 (biological evaluation of medical devices*). *MicroMol GmbH is accredited for the biological evaluation of medical devices according to DIN EN/ISO 10993-5 Negative control (medium) L-Methionine (5%) L-Methionine (2.5 %) L-Methionine (1 %) L-Methionine (0.5 %) L-Methionine (0.1 %) Positive control (Phenol 1 %) Score Viability (%) Cytotoxicity (%) 1 100 0 0.75 2 33 67 0.25 2 38 62 0.3 2 60 40 0.44 1 73 27 0.54 1 87 13 0.63 3 6 94 0.05 Reactivity (OD) Table 2: Evaluation of the toxic potential of L-Methionine in various concentrations. 10

Features: Primary screening platform for feed compounds and components based on a cytotoxicity assay with a functional active chicken enterocyte cell lines as target Functionality proven by response to various biological stimuli (Lipopolysaccharide, Campylobacter infection) Fast and significant results on the cellular level Platform implemented strictly according to thedemandsofthedin ISO10993-5 11

06 For further information or to place an order please contact us: Hedwigstr. 2-8 D-76199 Karlsruhe Contact: Dr. Wolfgang Rudy Phone: +49 721/9415213 Fax: +49 721/9415214 Mail: w.rudy@micromol.com Web: www.micromol.com