Genetics Lecture 16 Forensics DNA Forensics Genetics is arguably the most influential science today dramatically affecting technologies in fields as diverse as agriculture, archaeology, medical diagnosis, and disease treatment. One of the areas that has been the most profoundly altered by modern genetics is forensic science. Forensic science (or forensics) uses technological and scientific approaches to answer questions about the facts of criminal or civil cases. Pi Prior to 1986, forensic scientists t hd had a limited it array of tools with which to link evidence to specific individuals or suspects. These included some reliable methods such as blood typing and fingerprint analysis, but also many unreliable methods such as bite mark comparisons and hair microscopy. 2 Since the first forensic use of DNA profiling in 1986, DNA forensics (also called forensic DNA fingerprinting or DNA typing) has become an important method for police to identify sources of biological materials. DNA profiles can now be obtained from saliva left on cigarette butts or postage stamps, pet hairs found at crime scenes, or bloodspots the size of pinheads. Even biological samples that are degraded by fire or time are yielding DNA profiles that help the legal system determine identity, innocence, or guilt. Investigators now scan large databases of stored DNA profiles in order to match profiles generated from crime scene evidence. DNA profiling has proven the innocence of hundreds of people who were convicted of serious crimes and even sentenced to death. Forensic scientists have used DNA profiling to identify victims of mass disasters such as the Asian Tsunami of 2004 and the September 11, 2001 terrorist attacks in New York. They have also used forensic DNA analysis to identify endangered species and animals trafficked in the illegal wildlife trade. The power of DNA forensic analysis has captured the public imagination, and DNA forensics is featured in several popular television series. 3 1
The applications of DNA profiling extend beyond forensic investigations. These include paternity and family relationship testing, identification of plant materials, verification of military casualties, and evolutionary studies. It is important for all of us to understand the basics of forensic DNA analysis. As informed citizens, we need to monitor its uses and potential abuses. 4 DNA Profiling Methods VNTR Based DNA Fingerprinting The era of DNA based human identification began in 1984, with Dr. Alec Jeffreys s publication on DNA loci known as minisatellites, or variable number of tandem repeats (VNTRs). VNTRs are located in noncoding regions of the genome and are made up of DNA sequences of between 15 and 100 bp long, with each unit repeated a number of times. The number of repeats found at each VNTR locus varies from person to person, and hence VNTRs can be from 1 to 20 kilobases (kb) in length, depending on the person. For example, the VNTR 5 GACTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTA AGAT 3 is comprised of three tandem repeats of a 16 nucleotide sequence. 5 VNTRs VNTRs are useful for DNA profiling because there are as many as 30 different possible alleles (repeat lengths) at any VNTR in a population. This creates a large number of possible genotypes. For example, if one examined four different VNTR loci within a population, and each locus had 20 possible alleles, there would be more than 2 billion (4 20 )possible genotypes in this four locus profile. 6 2
To create a VNTR profile (also known as a DNA fingerprint), scientists extract DNA from a tissue sample and digest it with a restriction enzyme that cleaves on either side of the VNTR repeat region. Separated DNA is transferred from the gel to a membrane and hybridized with a radioactive probe that recognizes DNA sequences within the VNTR region. After exposing the membrane to X ray film, the pattern of bands is measured, with larger VNTR repeat alleles remaining near the top of the gel and smaller VNTRs, which migrate more rapidly through the gel, being closer to the bottom. The pattern of bands is the same for a given individual, no matter what tissue is used as the source of the DNA. If enough VNTRs are analyze, each person s DNA profile will be unique because of the huge number of possible VNTRs and alleles. In practice, scientists analyze about five or six loci to create a DNA profile. 7 8 A significant limitation of VNTR profiling is that it requires a relatively large sample of DNA (10,000 cells or about 50 pg of DNA) more than is usually found at a typical crime scene. In addition, the DNA must be relatively intact (nondegraded). As a result, VNTR profiling has been used most frequently when large tissue samples are available such as in paternity testing. 9 3
Autosomal STR DNA Profiling The development of the polymerase chain reaction (PCR) revolutionized DNA profiling. Using PCR amplified DNA samples, scientists are able to generate DNA profiles from trace samples (e.g., the bulb of single hairs or a few cells from a blood stain) and from samples that are old or degraded (such as a bone found in a field or an ancient Egyptian mummy). 10 The majority of human forensic DNA profiling is now done using commercial kits that amplify and analyze regions of the genome known as microsatellites, or short tandem repeats (STRS). STRs are similar to VNTRs, but the repeated motif is shorter between two and nine base pairs, repeated from 7 to 40 times. Although hundreds of STR loci are present in the human genome, only a subset is used for DNA profiling. The FBI and other law enforcement agencies have selected 13 STR loci to be used as a core set for forensic analysis. 11 12 4
After DNA profiling, the profile can be directly compared to a profile from another person, from crime scene evidence, or from other profiles stored in DNA profile databases. The STR profile genotype of an individual is expressedasthe number of timesthethe STR sequence is repeated. 13 14 15 5
Y Chromosome STR Profiling In many forensic applications, it is important to differentiate the DNA profiles of two or more people in a mixed sample. For example, vaginal swabs from rape cases usually contain a mixture of female cells and male sperm cells. In addition, some crime samples contain evidence material from a number of male suspects. In these types of cases, STR profiling of Y chromosome DNA is useful. There are more than 200 STR loci on the Y chromosome that are useful for DNA profiling; however, fewer than 20 of these are used routinely for forensic analysis. PCR amplification of Y chromosome STRs uses specific primers that do not amplify DNA on the X chromosome. 16 One limitation of Y chromosome DNA profiling is that it cannot differentiate between the DNA from fathers and sons, or from male siblings,. This is because the Y chromosome is directly inherited from the father to his sons, as a single unit. The Y chromosome does not undergo recombination, meaning that less genetic variability exists on the Y chromosome than on autosomal chromosomes. Therefore, all patrilineal relatives share the same Y chromosome profile. Even two apparently unrelated males may share the same Y profile, if they also shared a distant male ancestor. 17 Mitochondrial DNA Profiling Another important addition to DNA profiling methods is mitochondrial DNA (mtdna) analysis. Between 200 and 1700 mitochondria are present in each human somatic cell. Each mitochondrion contains one or more 16 kb circular DNA chromosomes. Mitochondria divide within cells and are distributed to daughter cells after cell division. Mitochondria are passed from the human egg cell to the zygote during fertilization; however, as sperm cells contribute few if any mitochondria to the zygote, they do not contribute these organelles to the next generation. Therefore, all cells in an individual contain multiple copies of identical mitochondria derived from the mother. 18 6
The fact that mtdna is present in high copy numbers in cells makes its analysis useful in cases where crime samples are small, old, or degraded. mtdna profiling is particularly useful for identifying victims of mass murders or disasters, such as the Srebrenica massacre of 1995 and the World Trade Center attacks of 2001, where reference samples from relatives are available. The main disadvantage of mtdna profiling is that it is not possible to differentiate between the mtdna from maternal relatives or from siblings. Like Y chromosome profiles, mtdna profiles may be shared by two apparently unrelated individuals who also share a distant ancestor in this case a maternal ancestor. Researchers use mtdna profiles in scientific studies of genealogy, evolution, and human population migrations. 19 Single Nucleotide Polymorphism Profiling They may be base pair changes or small insertions or deletions. SNPs occur randomly throughout the genome and on mtdna, every 500 to 1000 nucleotides. This means that there are potentially millions of loci in the human genome that can be used for profiling. However, as SNPs usually have only two alleles, many SNPs (50 or more) must be used to create a DNA profile that can distinguish between two individuals as efficiently as STRs 20 21 7
Forensic SNP profiling has one major advantage over STR profiling. Because a SNP involves only one nucleotide of a DNA molecule, the theoretical size of DNA required for a PCR reaction is the size of the two primers and one more nucleotide (i.e., about 50 nucleotides). This feature makes SNP analysis suitable for analyzing DNA samples that are severely degraded. Despite this advantage, SNP profiling has not yet become routine in forensic applications. More frequently, researchers use SNP profiling of Y chromosome and mtdna loci for lineage and evolution studies. 22 Interpreting DNA Profiles After a DNA profile is generated, its significance must be determined. In a typical forensic investigation, a profile derived from a suspect is compared to a profile from an evidence sample or to profiles already present in a DNA database. lf the suspect s profile fl does not match that of the evidence profile or database entries, investigators can conclude that the suspect is not the source of the sample(s) that generated the other profile(s). However, if the suspect s profile matches the evidence profile or a database entry, the interpretation becomes more complicated. 23 In this case, one could conclude that the two profiles either came from the same person or they came from two different people who share the same DNA profile by chance. To determine the significance of any DNA profile match, it is necessary to estimate the probability that thetwo two profiles are a random match. The profile probability, or random match probability method gives a numerical probability that a person chosen at random from a population would share the same DNA profile as the evidence or suspect profiles. The following example demonstrates how to arrive at a profile probability. 24 8
25 The Uniqueness of DNA Profiles Theoretically if a sufficient number of loci were analyzed, we could be almost certain that the DNA profile was unique. At the present time, law enforcement agencies in North America use a core set of 13 STR loci to generate DNA profiles. A hypothetical genotype comprised of the most common alleles of each STR locus in the core STR profile would be expected to occur only once in a population of 10 billion people. Hence, the frequency of this profile would be 1 in 10 billion. 26 Although this would suggest that most DNA profiles generated by analysis of the 13 core STR loci would be unique on the planet, several situations can alter this interpretation. For example, identical twins share the same DNA, and their DNA profiles will be identical. Identical twins occur at a frequency of about 1 in 250 births. In addition, siblings can share one allele at any DNA locus in about 50 percent of cases and can share both alleles at a locus in about 25 percent of cases. Parents and children also share alleles, but are less likely than siblings to share both alleles at a locus. When DNA profiles come from two people who are closely related, the profile probabilities must be adjusted to take this into account. The allele frequencies and calculations that we describe here are based on assumptions that the population is large and has little relatedness or inbreeding. lf a DNA profile is analyzed from a person in a small interrelated group, allele frequency tables and calculations may not apply 27 9
The Prosecutor s Fallacy It is sometimes stated, by both the legal profession and the public, that the suspect must be guilty given that the chance of a random match to the crime scene sample is 1 in 10 billion greater than the population of the planet, This type of statement is known as the prosecutor s fallacy because it equates guilt with a numerical probability derived from one piece of evidence, in the absence of other evidence. A match between a suspect s DNA profile and crime scene evidence does not necessarily prove guilt, for many reasons such as human error or contamination of samples, or even deliberate tampering. In addition, a DNA profile that does not match the evidence does not necessarily mean that the suspect is innocent. For example, a suspect s profile may not match that from a semen sample at a rape scene, but the suspect could still have been involved in the crime, perhaps by restraining the victim. 28 DNA Profile Databases Many countries throughout the world maintain national DNA profile databases. The first of these databases was established in the UK in 1995 and now contains more than 5 million profiles representing almost 10 percent of the population. In the UK, DNA samples can be taken from anyone arrested for an offense that could lead to a prison sentence. 29 In the United States, both state and federal governments have DNA profile databases. The entire system of databases along with tools to analyze the data is known as the Combined DNA Index System (CODIS) and is maintained by the FBI. At the beginning of 2010, there were more than 8 million DNA profiles stored within the CODIS system. The two main databases in CODIS are the convicted offender database, which contains DNA profiles from individuals convicted of certain crimes, and the forensic database, which contains profiles generated from crime scene evidence. In addition, some states have DNA profile databases containing profiles from suspects and from unidentified human remains and missing persons. Suspects who are not convicted can request that their profiles be removed from the databases. 30 10
DNA profile databases have proven their value in many different situations. As of January 2010, use of CODIS data bases resulted in more than 100,000 profile matches that assisted criminal investigations and missing persons searches. Despite the value of DNA profile databases, they remain a concern for many people who question the privacy and civil liberties of individuals versus the needs of the state 31 Technical and Ethical Issues Surrounding DNA Profiling Although DNA profiling is sensitive, accurate, and powerful, it is important to be aware of its limitations. Onelimitation is thatmost criminal cases have either no DNA evidence for analysis, or DNA evidence that would not be informative to the case. In some cases, potentially valuable DNA evidence exists but remains unprocessed and backlogged. 32 Another serious problem is that of human error. There are cases in which innocent people have been convicted of violent crimes based on DNA samples that had been inadvertently switched during processing. DNAevidence samples from crime scenes are often mixtures derived from any number of people present at the crime scene or even from people who were not present, but whose biological material (such as hair or saliva) was indirectly introduced to the site. 33 11
deliberate tampering One of the most disturbing problems with DNA profiling is its potential for deliberate tampering. DNA profile technologies are so sensitive that profiles can be generated from only a few cells or even from fragments of synthetic DNA. There have been cases in which criminals have introduced biological material to crime scenes, in an attempt to affect forensic DNA profiles. It is also possible to manufacture artificial DNA fragments that match STR loci of a person s DNA profile. 34 In 2010, a research paper reported methods for synthesizing DNA of a known STR profile, mixing the DNA with body fluids, and depositing the sample on crime scene items. When subjected to routine forensic analysis, these artificial i samples generated tdperfect tstr profiles. In the future, it may be necessary to develop methods to detect the presence of synthetic or cloned DNA in crime scene samples. It has been suggested that such detections could be done, based on the fact that natural DNA contains epigenetic markers such as methylation. 35 Many of the ethical questions related to DNA profiling involve the collection and storage of biological samples and DNA profiles. Should police be able to collect DNA samples without a suspect s knowledge or consent? Who should have their DNA profiles stored on a database? Should law enforcement agencies reveal the identities of people whose DNA profiles partially match those of a suspect, on the chance that the two individuals are related? Should researchers have access to DNA databases for research purposes? Could DNA profiles be associated with regions of the genome that might reveal information about a person s health, racial background, or appearance and if so, should that be admissible evidence? 36 12