AP Biology Investigation 9: Biotechnology:Restriction Enzyme Analysis of DNA In this investigation, you will learn how to use restriction Learning Objectives enzymes and gel electrophoresis to create genetic profiles. You will use these profiles to help narrow the list of suspects in the hypothetical crime. Pearson Education, Inc., publishing as Person Benjamin Cummings College Board, AP Biology Curriculum Framework 2012-2013 Copyright Rebecca Rehder Wingerden PreLab: Complete Bozeman Science- Molecular Biology Questions in CompBook (handout online) - http://www.bozemanscience.com/molecule-biology PreLab: Complete Activity - A Process To Dye For: Gel Electrophoresis in CompBook (handout) - Read Introduction, Background & Experimental Overview - Complete Pre-Lab Activity 1- (# is a Table 1) - Copy Gel Drawing Worksheet (Figure 1) Lab: Complete Procedure steps 1-11 and collect data & draw gel BozemanScience.com: AP Biology Lab 6 - Molecular Biology (9:00 min.) http://www.bozemanscience.com/ap-bio-lab-6-molecular-biology Post Lab: Complete Post-Lab Questions 1-10
Electrophoresis Equipment Electrophoresis - Loading the Gel - Buffer Cathode Dyes Agarose gel Anode + Power supply and chamber- a source of negatively charged particles with a cathode and anode Buffer- a fluid mixture of water and ions Agarose gel- a porous material the DNA migrates through DNA ladder- mixture of DNA fragments of known lengths Loading dye- contains a dense material and allows visualization of DNA migration DNA Stain- allows visualization of DNA fragments after electrophoresis Power Supply Analysis: Collect data to complete Table 1: Gel Electrophorese Complete Fig. 1 Gel Drawing Table 1: Gel Electrophoresis Dye Name Dye Well # Malachite Green 1 Orange G 2 Safranin O 3 Alizarin Red S m-cresol Purple Migration Migration Direction (+/-) Dye Molecules Speed Ranking Unknown Sample letter? NA NA NA Post Lab: Complete Post-Lab Questions 1-10 Figure 1: Gel Drawing - 1 2 3? - + +
Background DNA Restriction enzymes found naturally in bacteria, can be used to cut DNA fragments at specific sequences, while another enzyme, DNA ligase, can attach or rejoin DNA fragments with complementary (sticky) ends. More than 200 restriction enzymes now available commercially, they are named after the bacterium in which they were first identified: - EcoRI was the first enzyme isolated from Escherichia coli - HindIII was the third enzyme isolated for Haemophilus influenzae (restriction enzyme we will be using in DNA Forensic Lab) How do restriction enzymes work? Each restriction enzyme digest (cuts) DNA at a specific sequence, called the restriction site. Sticky Ends - ligation is very specific Eco RI GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCA CCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGT GGCCTGCG AATTCCCGATCGAAGGCCCG AATTCTGGCCA CCGGACGCTTAA GGGCTAGCTTCCGGGCTTAA GACCGGT Blunt Ends - ligation is non-specific Hae III GGCCTGCGAATTCCCGATCGAAGGCCCGAATTCTGGCCA CCGGACGCTTAAGGGCTAGCTTCCGGGCTTAAGACCGGT GG CCTGCGAATTCCCGATCGAAGG CCCGAATTCTGG CCA CC GGACGCTTAAGGGCTAGCTTCC GGGCTTAAGACC GGT How do we visualize the DNA? Agarose Gel Electrophoresis is a method of separating molecules in an electrical field based on their and charge; DNA has an overall negative charge Agarose gel acts as a sieve for separating DNA fragments; smaller fragments travel faster than large fragments Concentration of the agarose gel affects DNA migration - Low Concentration = larger pores -- better resolution of larger DNA fragments - Higher Concentration = smaller pores -- better resolution of smaller DNA fragments 1% agarose 2% agarose
Agarose Gel Forensic DNA Fingerprinting Restriction Enzymes A A G C T T T T C G A A HindIII (Hin D Three) restriction enzyme DNA Fragments Standard Lambda/HindIII CS S1 S2 S3 S S Molecules are separated based on their and charge. DNA has an overall negative charge. PreLab Complete the following before conducting this investigation: I. Read Investigation 9: Biotechnology: Restriction Enzyme Analysis of DNA II. Answer the following PreLab questions in your Comp Book: 1. Summarize what you will be doing in this investigation. 2. What is the primary question you will be trying to answer in this investigation? Inv. 9: Biotechnology: Restriction Enzyme Analysis of DNA PreLab - Getting Started: Define: Restriction Enzyme, PCR, RFLP, and Gel Electrophoresis Activity I: Restriction Enzyme 2Q p. S113-S11 Activity II: DNA Mapping Using Restriction Enzymes Q p. S11-S11 (Note: There are a total of questions in the 2 bullets.) Activity III: Basic Principle of Gel Electrophoresis 1Q p. S11
Forensic DNA Fingerprinting Procedure: Lesson 1 Restriction Digestion Steps 1-8 Pipet 10 µl of each DNA sample from the stock tubes and transfer to corresponding colored micro centrifuge tubes. Make sure the samples transferred to the bottom of the tubes. Forensic DNA Fingerprinting Procedure: Lesson 1 Restriction Digestion Steps 1-8 Using a fresh tip for each DNA sample, pipet 10 µl of ENZ into the bottom of each tube. DNA ENZ HindIII (Hin D Three) restriction enzyme CS S1 S2 S3 S S CS S1 S2 S3 S S Forensic DNA Fingerprinting Procedure: Lesson 1 Restriction Digestion Steps 1-8 Forensic DNA Fingerprinting Procedure: Lesson 2 Agarose Gel Electrophoresis Steps 7-9 Tightly cap the tubes and mix the components by gently flicking the tubes with your finger. Place tubes in your labeled floating micro-centrifuge tube rack and give to instructor. S CS S1 S2 S3 S S Using a separate tip for each sample, load 10 µl of Standard and 20 µl of digested DNA samples in to the correct wells of gel. CS S1 S2 S3 S S S CS S1 S2 S3 S S
Loading Dye - DNA samples are loaded using the dry method. Samples are loading into the wells using a micro pipet. The presence of dyes in the DNA samples allows visualization while running the gel. The dyes must not be allowed to run off the gel. Designing and Conducting Your Investigation: The Disappearance of Ms. Mason: Your task is to design and conduct a procedure based on DNA evidence to determine whose blood is spattered on the classroom floor. - Purpose: What is the goal of this investigation? - Hypothesis: If (rational for the investigation), then (outcome that you would expect). - Procedure: Steps outlining the lab techniques that you will complete to test your hypothesis (Include the following techniques in your procedure: PCR, RFLP, and gel electrophoresis.) - Data: Table 1: Electrophoresis Data: DNA Fingerprints of Five Suspects - Approval by Instructor Table 1: Electrophoresis Data: DNA Fingerprints of Five Suspects Band Lambda/ HindIII Size Standard 1 23,130 2 9,16 3 6,7,361 2,322 6 2,027 Crime Scene Suspect 1 Ms. Mason Suspect 2 Mr. Gladson Suspect 3 Bobby Suspect Unknown A Suspect Unknown B Designing and Conducting Your Investigation: - Evidence collected: Crime Scene DNA- blood spatter in classroom (SC) Ms. Mason s DNA- saliva on her coffee cup (S1) Mr. Gladson s DNA- tissue with which he wiped his nose (S2) Bobby s DNA- bubble gum (S3) Unknown A DNA- blond hair (S) Unknown B DNA- brown hair (S)
DNA Fragment Size (#bp) Analyzing and Evaluating Results: Complete Graph 1: Standard Curve ~ Lambda/ HindIII Size Standard Complete Table 1: Electrophoresis Data: DNA Fingerprints of Five Suspects Conclusion: Write a conclusion which takes into account the DNA results at the crime scene. Your conclusion should address who-dun-it by including motive, means, opportunity, and the DNA evidence found in Ms. Mason s classroom. Evaluating Results: #1-2 (p. S122) Thinking About Your Results: #1- (p. S123) Analyzing Results: Calculating the Sizes of Restriction Fragment Length Polymorphisms (p. S120) base pair length is substituted for molecular weight when determining the of DNA fragments. Creating the Standard Curve: - Graph 1: Standard Curve - Table 1: DNA Fragment - Migration 11.00 mm 13.00 mm 1.00 mm * For this ideal gel, assume that these two bands appear as a single band instead of resolving into separate bands. ** These bands do not appear on the ideal gel and likely will not be seen. Graph 1: Standard Curve ~ Lambda/ HindIII Size Standard i.e. band #1 is 23,130 bp and it migrated 11 mm i.e. band #2 is 916 bp and it migrated 13 mm i.e. band #3 is 67 bp and it migrated 1 mm x10, 000 x1,000 x100 00 3300 2200 1100 9 90 8 80 7 70 6 3 2 1 9 8 7 6 3 2 60 0 0 30 20 10 9 8 7 6 3 2 NOTE: The first fragment is too large to migrate properly in agarose and will not fit within your line of best fit, and should be discarded. 1 1 0 1 2 3 6 7 8 9 10 0 10 20 30 0 0 60 70 80 90 100 Migrated Complete Activity- Restriction Enzyme Cleavage of DNA (EDVOTEK 112) PreLab - Read Background Information and Experimental Procedure (p. -9) Copy data tables: Table 1: DNA Marker Standard Table 2: Lambda DNA cut with EcoRI Table 3: Lambda DNA (UNcut) Figure 1: Lambda DNA cut with EcoRI
Complete Activity- Restriction Enzyme Cleavage of DNA (EDVOTEK 112) Complete Procedure steps 1-6 (p.9) Collect Data: Table 1: DNA Marker Standard Table 2: Lambda DNA cut with EcoRI Table 3: Lambda DNA (UNcut) Analysis: Graph: Size Determination of DNA Restriction Fragments (p.10) Answer Study Questions #1-2 (p. DNA Ladder - known quantities of DNA Lambda DNA Lambda DNA 12) Lambda DNA cut with EcoRI Table 1: DNA Marker Standard - Lane 1 Fragment Migrated Length 1 (top) 23109 2 916 3 67 361 3000 6 2322 7 2027 8 72 9 70 NOTE: The first fragment is too large to migrate properly in agarose and will not fit within your line of best fit, and should be discarded. Table 2: Lambda DNA cut w/ Eco RI - Lane 2 Fragment Migrated Length 1 2 3 6 Table 3: Lambda DNA (UNcut) - Lane 3 Fragment 1 Migrated Length Use the best fit line on your graph (Determination of Unknown DNA Fragment Size) to determine the length of the DNA fragments in lanes 2 and 3. Figure 1: Lambda DNA cut with EcoRI
#1 = 18mm #2 =? mm #3 =? mm Lane 1: DNA Marker Standard 1 2 3 Table 1: DNA Marker Standard - Lane 1 Fragment Migrated Length 1 (top) 18 23109 2? mm 916 3? mm 67 361 3000 6 2322 7 2027 8 72 9 70 NOTE: The first fragment is too large to migrate properly in agarose and will not fit within your line of best fit, and should be discarded. Graph 1: Determination of Unknown DNA Fragment Size DNA Fragment Size (#bp) x10, 000 x1,000 #1 =? mm #2 =? mm #3 =? mm Lane 2: Lambda DNA cut w/ Eco RI 1 2 3 i.e. fragment #2 is 916 bp and it migrated 23 mm x100 10 20 30 0 0 60 70 80 Migrated
Table 2: Lambda DNA cut w/ Eco RI - Lane 2 Fragment Migrated Length 1? mm 2? mm 3? mm 6 #1 =? mm Lane 3: Lambda DNA (UNcut) 1 2 3 Table 3: Lambda DNA (UNcut) - Lane 3 Fragment Migrated Length 1? mm Use the best fit line on your graph (Determination of Unknown DNA Fragment Size) to determine the length of the DNA fragments in lanes 2 and 3. Complete Activity- Restriction Enzyme Cleavage of DNA (EDVOTEK 112) Complete Procedure steps 1-6 (p.9) Collect Data: Table 1: DNA Marker Standard Table 2: Lambda DNA cut with EcoRI Table 3: Lambda DNA (UNcut) Analysis: Graph: Size Determination of DNA Restriction Fragments (p.10) Answer Study Questions #1-2 (p. 12) DNA Ladder - known quantities of DNA Lambda DNA Lambda DNA Lambda DNA cut with EcoRI