Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from a pdest. 3. Open your plasmid with the enzyme of choice. 4. Create blunt ends in your plasmid by T4 DNA polymerase treatment. 5. To avoid self-ligation treat the plasmid with CIP. 6. Amplify by PCR the Gateway cassette of choice. 7. Perform a T4_kinase treatment. 8. Ligate the Gateway cassette with the open plasmid by T4 ligase. 9. Transform with ccdb SurvivalTM 2 T1R competent Cells 10. Analyze the transformants Example: In the following example we are going to convert a plasmid with a C-terminal tag into gateway compatible cloning. 1. Selection of right Gateway Cassette and Enzyme to open the plasmid. Select the right Gateway cassette (A, B or C) according with the position of the tag in your plasmid (at N- or C-terminal). Also verify what enzyme will be the best to open the plasmid. Check the Gateway Convertion Kit manual for more details. In this example the Gateway cassette B is ideal because it will be in frame with a C-terminal tag from the plasmid. For this example the plasmid needs to be open with BamIII. 2. Design primers to amplify the right Gateway cassette from a pdest. Do not add extra bases at the ends. Alternatively you can get the Gateway Conversion kit (Invitrogen 11828-029) Primer Sequence Tm Forward primer ATCAACAAGTTTGTACAAAAAAGC 60 Reverse primer ATCAACCACTTTGTACAAGAAAGCTG 65
3. Opening the plasmid. In this example we digest the plasmid with BamHI. It is important to start with at least 4 µg of plasmid since the amount will decrease due cleaning steps. Opening plasmid Reaction Amount plasmid (144 ng/µl) 30 4 µg NEB Buffer 3 10x BamHI 5 1 20U H20 (BSA 100µg/ml) 14 Clean the reaction with spin-column purification (Qiagen). 4. Create blunt ends in your plasmid by T4 DNA polymerase treatment. If the enzyme digestion does not generate blunt ends, then is necessary to create them with a treatment with T4 DNA Polymerase (NEB M023S). In this example the reaction is: Blunt ends with T4 DNA polymerase Reaction Concentration Digested plasmid (86ng/ml) 30 2580 T4 DNA polymerase 1 1U/µg dntps [10mM] 1 Buffer 2 10x 5 H20 (BSA 100µg/ml) 13 Incubate 12 C for 15 min Inactivate 75 C for 20 min. 5. To avoid self-ligation treat the plasmid with CIP. We used Alkaline Phosphatase, Calf Intestinal (CIP) (Finnzymes F-201S). CIP catalyses the removal of 5' phosphate residues from DNA to prevent self ligation. The manual of CIP recommends to calculate 1 pmol (1µM) of plasmid, in this example the plasmid has a size of 4026pb and according with the following formula: pmoles (µm) x length x 650 /10 6 = ng 1 pmol x 4026 x 650/ 10 6 = ng 1 pmol = 2616 ng
The CIP treatment is as the following: CIP treatment Plasmid (open+t4 treated) (86ng/ml) 50 2.6µg = 1pmol CIP 0.5 Buffer 10X 5 Water X Incubate 37 C for 1 hr Inactivate 65 C for 15 min Although the CIP manual does not comment about heat inactivation, this step is added in order to avoid another spin-column cleaning (and reduce the amount of plasmid). 6. Amplify by PCR the Gateway cassette of choice. Amplify by PCR the gateway cassette from a pdest with primers designed in step 2. Use a High Fidelity DNA Polymerase that generates blunt ends i.e Phusion (Finnzymes F-530S). PCR Master mix 1x 4X PCR conditions Buffer HF 5x 10 40 Temperature Time Cycles Forward primer (10µM) 1 4 98 C 30s 1 Reverse primer (10µM) 1 4 94 C 10s dntps [10mM] 1 4 60 C 30s 30 pdest (200 ng/µl) 0.5 2 72 C 30s Phusion enzyme 2 U/µl 1 4 72 C 7 min 1 H2O 35.5 142 4 C 1 min 1 200 PCR from Cassette B using pcdna6.2 N-eGFP as a template. The PCR product is 1713 pb Run the PCR product in an agarose gel, cut the right band and clean it with a spin column purification (i.e. Qiagen). 7. Perform a T4_kinase treatment with the PCR product To clone blunt-end fragments is necessary that the insert has a 5' phosphate residues, normal PCR primers are provided without them, if that is the case a step with a T4_kinase is needed to add them. At this stage the plasmid does not have 5' phosphates since they were eliminated with the CIP treatment in step 5. An example of the T4_kinase (NEB M0201S) is as the following: T4_kinase treatment Reaction Gateway cassette 17ng/µl 44 T4_kinase Buffer 10x 5 T4_kinase 10U/µl 1 Incubate 30 min at 37 C Inactivate enzyme 65 C 20 min
8. Ligate the Gateway cassette with the open plasmid using T4 ligase. Now is time to join the Gateway cassette and the plasmid. Try molar ratios of 1:1 and 1:3 (insert/vector). Here is a Promega tool that helps with that calculations. The following is an example of a typical T4 ligase (NEB M0202S) reaction: T4 DNA ligase reaction 1 2 Tube1 Tube2 Gateway cassette B_kinase treated 17ng/µl 2.2 3.3 Ratio 1:1 Ratio 1:3 Plasmid (open/t4/cip/treated) 40ng/µl 2.5 1.2 37.5ng 56.3ng Buffer 10x 1 1 100ng 50ng T4 DNA ligase 1 1 H2O 3.3 3.5 total 10 10 Incubate overnight 20 C Inactivate 65 C for 10 minutes To be in the safe side leave the incubation overnight and inactivate with heat. 9. Transformation Now the plasmid contains the Gateway cassette and therefore it needs to be cloned in competent cells that are resistant to ccdb gene. Take 2µl of the ligation and transform in ccdb SurvivalTM 2 T1R competent Cells (Invitrogen A10460) follow the protocol. Be sure to plate the cells on a LB-agar dish with a proper antibiotic (resistance from the original plasmid) plus 30µg/ml of Cloramphenicol. 10. Analyze the transformants Since a blunt-end ligation was done then 50% percent of the colonies will have the insert in the right orientation and in the other 50% the insert will be inverted. Select several colonies and analyze them by enzyme digestion. Digestion analysis with SphI and BamHI of a plasmid converted to gateway compatible cloning. According with the expected digestion pattern samples on wells 7-10 and 13 have the right construct. Samples in wells 1,2,4,6,11,12,14-16 have the gateway cassette inverted.
Sequence the positive clones to verify that the Gateway cassette is in frame with the C-terminal tag. Design primers at about 50 bp from the join insert/plasmid: For plasmids with a C-terminal tag the triplet AAA located at the att2 sequence (gateway cassette) must be in frame with the start codon of the C-terminal tag. References http://tools.invitrogen.com/content/sfs/manuals/gatewayvectorconversion_ccdbsurvival2_man.pdf http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/cloning_guide.asp