DNA: Biology & the Basics of DNA Typing Mary Dayton Assistant Public Defender Law Office of the DeKalb County Public Defender Stone Mountain Judicial Circuit 404.371.2222 mfdayton@dekalbcountyga.gov
The History of DNA Discovered in 1869 by Friedrich Miescher In 1953 Watson and Crick double helix model of DNA structure In 1985 Alec Jeffreys discovered that portions of the DNA structure are unique to each individual Fun Fact: Proved the police wrong wrong suspect/ false confession
What is DNA? The genetic material of all living organisms Called the the chemical blueprint of life or the building blocks of life In higher animals, DNA is organized into structures known as chromosomes, found in the nucleus of cells All human cells (except red blood cells) contain nuclear DNA
DNA Basics: Structure Double Helix DNA is a Polymer large number of atoms arranged in repeating units of nucleotides Nucleotides are composed of: a sugar molecule a phosphorus group nitrogen bases
DNA has 4 Nitrogen Bases 1. Adenine 2. Guanine 3. Cytosine 4. Thymine Adenine will always combine with Thymine Guanine will always combine with Cytosine There are no exceptions to this rule!
Complementary Base Pairing Any base can follow another in the DNA sequence, making the number of differing combinations staggering
The Big (little) Picture Chromosome a rod like structure in the cell nucleus Humans have 46 Composed of DNA Inherit one chromosome from mother and one from father Will pair up = 23 pair of chromosomes X and Y are the sex chromosomes XX = female XY = male
Gene A unit of inheritance within the DNA segment About 5% of human DNA consists of coding regions (i.e. eye color, hair color, etc.) The other 95% contains non coding regions of DNA
Alleles Refers to alternative forms of a gene Example: Everyone has a gene for eye color The different alleles for eye color would be:
Locus or Loci Point Refers to the location of the gene on a chromosome Think of it like a street address
What does DNA do? Some genes code for genetic traits i.e. eye color blood type curl tongue left vs. right thumb trick, etc. The majority of DNA is non coding those regions contain tandemly repeated sequences of the base nucleotides (ATGC) While they are not outwardly visible to the eye, these segments are what is so important to DNA typing
Tandem Repeats Tandem repeated sequences have core repeats of the 4 nucleotide bases that range from 2 base pairs to over 100 base pairs The number of these repeats is extremely variable from person to person
Mid 1990s Present Day Short Tandem Repeats STRs A region of a DNA molecule that contains short segments consisting of 2 6 repeating base pairs of nucleotides (ATGC) Most successful and widely used DNA profiling procedure Less susceptible to degradation; can be recovered from bodies in extreme decomposition Easily multiplied in the lab so that there is enough DNA for all testing that is needed In the USA the forensic community has named 13 STRs for entry into the national database called CODIS
13 loci used in CODIS
Inheritance of STRs Possible STR Combinations: Chromosome 5 loci point 818 (AGAT) Father STRs 14, 15 Mother STRs 9, 12 9, 14 9, 15 12, 14 12, 15
How to Read DNA Markers Example: D16S539 D= DNA 16= Chromosome 16 S= single copy sequence 539= the 539 th locus described on chromosome 16 What does D21S11 mean?
Example: Locus: D5S818 Alleles: 7,9 Paternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATCC Maternal chromosome 5 CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC
Steps in the DNA Typing Process Serology Biology DNA extraction DNA quantitation PCR amplification Technology Separation and detection of STR alleles DNA profile determination Genetics Comparison of DNA profile Unknown profiles from crime scene Known samples from victims/suspect Submit to CODIS
Example: DNA profile found from crime scene evidence
DNA Profiles are compared TPOX CSF1PO D5S818 D8S1179 Blood stain 7,9 10,13 7,15 8,8 Suspect 1 8,9 10,10 9,10 11,12 Suspect 2 10,11 9,13 8,14 9,12 Suspect 3 7,9 10,13 7,15 8,8
Combined DNA Index System CODIS National DNA database Run by the FBI Uses the 13 core STRs** DNA profiles are submitted by states Offender profiles Currently at approximately 15 million profiles Unknown profiles From crime scenes
DNA and Statistics The final result is presented as a statistic. Do not say: The DNA in the bloodstain is John Doe s DNA. Do say: The chance that another person has this DNA in the bloodstain is 1 in 300 billion.
Where do the statistics come from? First, the frequency of each allele is estimated using data from a population data base. Locus: D5S818 Alleles: 7,9 Allele frequency from database 7 26% 9 11%
Where do the statistics come from? Next, the frequency of the genotype at each locus is calculated. Locus: D5S818 Alleles: 7,9 Genotype frequency 6%
For total frequency, multiply all of the frequencies together. D5 = 6% D8 = 12% D18 = 0.5% Total = 0.004%
Obtaining DNA Reference Samples Evidence can only attain forensic value if the analyst has a reference sample to compare it against Victims and suspects will be asked to provide these reference samples in the form of drawn blood or a buccal swab of the cheek If the individual is missing, DNA reference samples can be obtained from: toothbrushes, razors, combs, and through mtdna obtained from the maternal line
Contamination of DNA Evidence Can occur through: Coughing or sneezing onto stain during collection Incorrect packaging for transport to lab Curious family members and extra police Not changing gloves and disposable tweezers frequently Time and nature of the crime scene Outside vs. Inside; Animal activity; Heat vs. Cold Contamination can easily been seen through STR lab testing More than 2 STR bands present suggests a DNA mixture from more than one source
Developing a theory of defense in a DNA case Claudia S. Saari Circuit Public Defender Law Office of the DeKalb County Public Defender Stone Mountain Judicial Circuit 404.371.2222 cssaari@dekalbcountyga.gov
Possible defense theories in a DNA case A third party is the actual perpetrator analyst mistakenly reported a match or inclusion Analyst exaggerated the degree that the DNA is consistent with your client A different analysis may exclude your client Contamination at the crime scene or laboratory Inadvertent transfer of DNA Defense theory is consistent with DNA, i.e. consent
Contamination at crime scene or lab Evidence collection: Who were they qualified Where where was evidence found What what was done to collect the evidence When when was evidence processed Why why were certain steps taken or not taken How how was evidence stored and processed
Inadvertent transfer of DNA Example: brother accused of murder of sister He used a towel in the morning Then she used the same towel so his DNA transferred to her face Killer wore gloves and strangled her Gloves found with brother s DNA Why? brother s DNA on sister s face from the towel transferred to killer s gloves
How to Prepare for a DNA Case Subpoena Information Speak with the analyst Know some of the science involved File motions
Subpoena Information Complete case file, lab notes, records, copies of all photographs All Correspondence, including emails Electronic data, i.e. injection log lists Laboratory protocols Quality control procedures, unexpected results log, corrective action taken Chain of custody
Subpoena Information, cont. Amount of material used, remaining material, how remaining evidence stored All software programs used in the DNA testing Electropherograms, table of alleles Database information Contamination Log Licenses or certificates of accreditation held by the DNA testing lab
Subpoena information, cont.. The CV of all the experts, proficiency test results, prior transcripts of their testimony Laboratory error rates/proficiency tests results
Speak with the analyst Gather information so do not need to be confrontational Help educate yourself on what testing was done Answer your questions before you ask them in court How will they do on the stand
Learn the science Read books and articles Forensic DNA Analysis by Norah Rudin and Keith Inman Forensic DNA Typing by John Butler Talk with the analyst Hire an expert to help you understand what testing was done, what evidence do you need to challenge, help with cross examination questions
File Motions Motion to exclude DNA Motions to exclude because low copy number less than 150 RFUs Compel the production of reports on near matching profiles in CODIS Motion to suppress evidence based on incomplete, misleading and unreliable affidavit in support of the search warrant to seize defendant s salvia
Motions, cont... Motion to prohibit expert from testifying that defendant is the source of the blood Motion to prohibit prosecution stating that they did not consume all DNA samples
Challenges to DNA Involves questions of: How was the DNA been identified How was the DNA collected How was the DNA preserved How was the DNA analyzed Was the DNA tested properly
Absence of DNA Evidence Think of every possible article that could have been tested, but was not and prepare an exhibit Argue that here is all the other evidence or other suspects that DNA could have been tested Not tested means no corroboration, means state did not meet their BOP, means reasonable doubt and you must acquit
Identifying DNA evidence Weapons sweat, skin, blood, tissue Hat, mask, bandana, sneakers, glasses sweat, hair Facial tissue mucus, blood, sweat, semen Dirty laundry blood, sweat, semen Cigarette saliva Stamp or envelope saliva Tape or ligature skin, sweat Bottle, can or glass saliva, sweat
Identifying DNA evidence, cont Used condom semen, vaginal or rectal cells Blanket, pillow, sheet sweat, hair, semen, urine, saliva Through and through bullet blood, tissue Bite mark saliva Fingernail or partial nail blood, sweat, tissue
Cross examination chapters Qualifications and Bias Crime scene collection and handling of evidence Evidence selection and labwork Interpretation of results Statistical value
Qualifications & Bias Are they neutral, objective witnesses or are they law enforcement Why do they need a police report Examiner bias Less qualified, less credible their opinion is Not licensed Minimal professional training Times qualified as an expert in molecular biology or population genetics
Crime scene collection and handling of evidence Earlier the possibility of contamination, the greater the risk of problems later Contamination at crime scene, by lab personnel, DA s office Poor packaging evidence was wet, items stored in the same bag Evidence stored for many months possible degradation Failed to collect other evidence Chain of custody log improper seal
Evidence selection & labwork What evidence should be tested is usually decided by the prosecutor Are they artifacts or stutter peaks or real genetic material that should be examined Object to peer review hearsay and improper bolstering ASCLAD recommends blind proficiency testing Any failed proficiency testing Every lab receives accreditation
Interpretation of results Number of crime lab personnel make mistakes or commit fraud Cannot testify as to how long DNA on sample evidence Amount of DNA tested is 1/10 of one grain of sugar PCR is highly sensitive to contamination Evolution of DNA testing always changing, always subject to human error Mixtures are difficult to interpret
Mixture samples Subjective as to who the major contributor is Do not know if genetic information is masked by alleles contributed by other people May be more contributors to the DNA than reported Many possible allele permutations opportunity for a false match in a database search of offenders Only takes one different allele at one locus to exclude your client
Peak or stutter Stutters appear before or after a true allele and may mask minor contributors Only if a peak height exceeds a certain value will it be counted so genetic material may be ignored When the quantity of DNA is very low, it is possible that the entire profile of the contributor will not be detected Degradation falling peak heights Peak heights imbalance peaks differing by more than 30% may come from different contributors
Touch DNA Analyze DNA transferred from one person to another by way of an object that both people have touched (i.e. pen, gun) From one piece of evidence to another by crime scene investigators Two items thrown together in an evidence bag California case
Statistical value what does the evidence really mean Evidence of a DNA match is inadmissible without statistics explaining its significance More genetic information you have, more discriminating the results Database in Georgia there is no database for Hispanics or Asian people and only has 298 samples Source attribution object to language of him or his identical twin, only report statistical number Reported stats are not the same as the probability your client is guilty or that they are the source of the crime scene sample
Statistical value, cont Stats are an estimated frequency they describe the frequency of occurrence of a particular genetic profile among unrelated persons selected at random Your client s genetic profile may be consistent with evidence from a crime scene, but this is not necessarily the same as an absolute identification