Real world applications of whole genome sequencing. Henrik Hasman Bacteria, parasites and fungi Statens Serum Institut, Denmark

Real world applications of whole genome sequencing Henrik Hasman Bacteria, parasites and fungi Statens Serum Institut, Denmark

REAL WORLD APPLICATIONS or application of WGS for outbreak detection, national surveillance and research at The Reference Laboratory for Antimicrobial Resistance Karin Sixhøj Pedersen, lab tech Frank Hansen, lab tech Louise Roer, PhD Anette M. Hammerum, PhD Henrik Hasman, PhD

Short introduction to me Molecular microbiologist Employed at DTU FOOD until 2015 working with bacterial typing and AMR Involved in the CGE project Co-organizer of a WGS course for clinical microbiologists Co-developer of ResFinder, PlasmidFinder, FimTyper, VirulenceFinder.. Employed at SSI working with bacterial typing and AMR.

Timeline for introduction to WGS in relation to AMR at SSI: 2013: Pilot projects (A. baumannii) using Whole-genome sequencing 2014-: WGS of ESBL-producing E. coli from bloodstream infections 2014-: WGS of carbapenemase producing bacteria 2015-: WGS for all clinical vancomycin resistant enterococci 2015-: Colistin resistant bacteria

CARBAPENEM RESISTANCE Carbapenems are among the last antibiotics for treatment of infections with multi-drug resistant bacteria (e.g. ESBL-producing E. coli or Klebsiella pneumoniae) Carbapenem resistant bacteria are often multi-resistant can only be treated with few (colistin and tigecyklin) or no antibiotics

Carbapenemases: Serin carbapenemases : KPC, GES-2, -4, -5, -6, -8, NMC, SME, IMI-1, -2 Metallo-beta-lactamases: IMP, VIM, SPM-1, GIM-1, SIM-1, AIM-1, KHM-1, NDM, DIM-1, TMB-1 Oxacillinases: OXA-23-gr, OXA-24-gr, OXA-58-gr, OXA-143, OXA- 48-gr K. pneumoniae E. coli other Enterobacteriaceae P. aeruginosa A. baumannii A. baumannii Enterobacteriaceae Red: Found in DK

RAPID GLOBAL SPREAD OF NDM-1 Canada USA UK Holland Belgium Hospitalization: India & Pakistan (Balkan-region) Nosocomial transmission France Norway Spain Sweden Italy Kenya Austria Oman Finland Denmark India Pakistan Australia Germany Slovenia China Japan Bangladesh Malaysia Taiwan Singapore 2010: 13 European countries Enterobacteriaceae K. pneumoniae, E. coli, K. oxytoca, E. cloacae, Proteus spp. M. morganii, C. freundii, Providencia spp. + + + + Pseudomonas spp., A. baumannii + + + +

Patient #1 at Aalborg hospital 80 year old male. Produced carbapenem resistant Citrobacter freundii isolated from urine on October 31. 2012 And a carbapenem resistant Citrobacter freundii isolated from fecal swap upon readmission on November 4. 2013 PCR identified the NDM-1 gene The isolates were subjected to WGS at SSI

Bioinformatic tools I

MLST, resistance genes and plasmid replicons Citrobacter freundii ST18 bla NDM-1 bla CMY-6 like bla CMY-79 like bla DHA-1 bla OXA-1 bla TEM-1b stra strb aac(6')-ib-cr aada5 rmtc cata1 sul1 sul2 dfra17 IncFIB IncA/C2 IncHI2 IncQ1 IncHI2A

Outbreak of NDM-1???? Patient 1 (80 yrs) Patient 2 (83 yrs) Patient 3 (63 yrs) Patient 4 (66 yrs) 31th Oct 2012 C. freundii(urine)* NDM-1 IncA/C plasmid, ST18 3rd Apr 2013 C. freundii(urine)* NDM-1,IncA/C plasmid, ST18 2nd Aug 2013 C. freundii(blood)* NDM-1, IncA/C plasmid, ST18 23rd Oct 2013 C. freundii(urine) NDM-1, IncA/C plasmid, ST18 4th Nov 2013 (re-admission) C. freundii(faecal swab) NDM-1IncA/C plasmids, ST18 21st May 2013 C. freundii (anal fissure)* NDM-1,IncA/C plasmid, ST18 K. pneumoniae (anal fissure) NDM-1 4th Nov 2013 C. freundii(faecal swab) NDM-1 IncA/C plasmid, ST18 K. pneumoniae (faecal swab) NDM-1 18th Dec 2013 K. pneumoniae (sputum)^ NDM-1 2012-2017: 16 patients No travel activity recorded 2nd Jan 2014 C. freundii(faecal swab) NDM-1 IncA/C plasmid, ST18 K. pneumoniae (faecal sw.) NDM E. coli (faecal swab) NDM-1

NDM-1 outbreak initial outbreak

Ridom SeqSphere cgmlst analysis (1701 genes) <8 alleles 44 alleles NCBI China Non-bla NDM-1 NCBI RefSeq + DK genome data

Patient #2 Citrobacter freundii ST18 bla NDM-1, bla CMY-6 like, bla CMY-79 like, bla DHA-1, bla OXA-1, bla TEM-1b stra, strb, aac(6')-ib-cr, aada5, rmtc, cata1, sul1, sul2, dfra17 IncFIB, IncA/C2, IncHI2, IncQ1, IncHI2A Klebsiella pneumoniae ST392 bla NDM-1, bla CMY-6 like, bla DHA-1, bla OXA-1, bla TEM-1b, bla SHV-11, bla CTX-M-15 stra, strb, aac(6')-ib-cr, aac(3)-iia, rmtc, fosa,catb3 sul1, sul2, qnrb66,teta, dfra14 IncFII(K), IncA/C2, IncFIB(K)

Patient #2 Citrobacter freundii ST18 bla NDM-1, bla CMY-6 like, bla CMY-79 like, bla DHA-1, bla OXA-1, bla TEM-1b stra, strb, aac(6')-ib-cr, aada5, rmtc, cata1, sul1, sul2, dfra17 IncFIB, IncA/C2, IncHI2, IncQ1, IncHI2A Klebsiella pneumoniae ST392 bla NDM-1, bla CMY-6 like, bla DHA-1, bla OXA-1, bla TEM-1b, bla SHV-11, bla CTX-M-15 stra, strb, aac(6')-ib-cr, aac(3)-iia, rmtc, fosa,catb3 sul1, sul2, qnrb66,teta, dfra14 IncFII(K), IncA/C2, IncFIB(K)

Illumina assembly data (CLC Genomic WB v9.0.1) IncA/C2 39120 bp 23 x coverage bla NDM-1 13230 bp 22 x coverage

Plasmid purification and llumina assembly data bla NDM-1 25121 bp 46 x coverage IncA/C2 123070 bp 44 x coverage No direct link between bla NDM-1 and the IncA/C2 replicon PCR linking ended in a wild-goose chase

Single Molecule Real Time (SMRT) Pacific Biosciences Assembly using SPADes (mixed assembly using also MiSeq data) 1500 $ Oxford Nanopore MinION Assembly using CANU and proofreading with MiSeq

Single Molecule Real Time (SMRT) sul1 aaca4 bla NDM-1 rmtc aac(6 )Ib-cr bla OXA-1 stra strb IncA/C2 bla CMY-6

BLAST atlas to pt1 (server.gview.ca)

NATIONAL SURVEILLANCE OF VANCOMYCIN RESISTANT ENTEROCOCCUS FAECIUM

ENTEROCOCCI Enterococci belong to the normal gastrointestinal flora of human and animals Enterococci extremely resistant to heat and can survives for extended periods on dry surfaces Enterococci are a common cause of hospital-acquired infections The most frequent infections caused by enterococci are: Urinary tract infections, bacteraemia and endocarditis E. faecalis has in the past causes the most human infections; however infections caused by E. faecium have become more frequent during the last decade Treatment: Combination of an aminoglycoside (gentamicin) and a cell-wallactive agent (penicillin or vancomycin)

VANCOMYCIN RESISTANT ENTEROCOCCI Many genes: vana, vanb, vanc, vand, vane, vang, vanl, vanm, vann and (vano) vana and vanb are most common The vana gene is typically located on transposons of the Tn1546 type Tn1546

WGS of VRE at SSI In 2014: - Isolates from bloodstream infections (n=32) 2015, 2016 and 2017: - All VRE from infections (n=375 for 2015) and (n=436 for 2016)

No. of isolates Clinical VRE (2005-2015) 500 450 n = 303 n = 375 n = 436 400 350 300 E. faecalis vanb 250 E. faecalis vana E. faecium vanb 200 E. faecium vana 150 100 50 0 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016

Distribution of vana E. faecium 2015 120 100 80 60 VR E 40 VR E VR E VR E VR E 20 0 89% of the isolates are from Zealand

STs for the 372 E. faecium from 2015 MLST based on 7 genes divided into 12 STs ST117 (10%) ST80 (33%) Total ST-117 ST-1196 ST-1197 ST-1198 ST-1199 ST-1200 ST-1201 ST-18 ST-192 ST-203 ST-80 Unknown ST ST203 (51%) Only few ST203 before 2015

SeqSphere (cgmlst) for E. faecium In 2016, sub-typning of VRE faecium was done using SeqSphere Comparison of 1423 genes Easy to communicate as a number (CT859) Easy to compare with other isolates in the database (including international isolates) cgmlst for E. faecium are very similar to data from SNP-trees

cgmlst tree (34 types) for 372 VRE faecium Total ST203 CT859 (51%) Only one isolates with another CT Comparison of 1423 gener ST80 into 12 cluster typer

ST203-CT859 70 VR E VR E VR E 60 50 VR E VR E 40 30 20 10 0 CT859 have been spread to Sweden and the Farroe Islands

No. of isolates CONCLUSION WGS and SeqSphere are useful for typing of E. faecium isolates VRE faecium clones are spread across hospitals and different regions in Denmark Fast clonal shifts - ST203-CT859 only few isolates in 2014, but 51% in 2015 and 65% in 2016. Total 14 15 16 20 24 46 859 860 861 862 500 400 300 200 100 0 E. faecalis vanb E. faecalis vana E. faecium vanb E. faecium vana 863

Colistin resistance (mcr-1 and mcr-2) Colistin can be used for treatment of infections caused to multi-resistant bacteria (carbapenemase-producing E. coli and K. pneumoniae) Colistin are used for both humans and animals Plasmid mediated colistin resistance (mcr-1) described in China in November 2015

RAPID RE-ANALYSIS (FROM LAB TO LAP-TOP) >mcr-1_1_kp347127 ATGATGCAGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGACCGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGC GGACAATCTCGGCTTTGTGCTGACGATCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTGATTTTGCTATTAATCATGGGCGCGGTGA CCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCAAAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTGTG CTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTGATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTA TGCCAGTTTCTTTCGCGTGCATAAGCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCAGTGCGCCAAAAGATACCATTTATCACGCCA AAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTGGTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGCCAAG ATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCAGCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCT GGATACGCTGGATCGCTTGGGCGTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTATAAATCCGCGACCAACAACGCCATCTGCAACA CCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAGATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTTAAGCGA TATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTTGATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCA GTGGCTGCAGACGCACAGCAATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATGCCAAATGCCTTTGCACCAAAAGAACAGCGCAGTG TGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAATGGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCAAAGACCGC ACCGCATTCATCCGCTGA Nov. 18. 2015 (Lancet Infect Dis) Nov. 24. 2015 (ResFinder) Nov. 30. 2015 (Contamination?) Dec. 07. 2015 (Resequencing) phnshp45 carrying the mcr-1 gene Nov. 23. 2015 (Genbank) Nov. 26. 2015 (NGS data scanned) Dec. 2. 2015 (1. draft MS) Dec. 10. 2015 (online in Eurosurveillance)

MCR-1 POSITIVE ISOLATES

REVERSE GENOTYPIC SCREENING Positive phenotype (unknown genotype) Negative phenotype

REVERSE GENOTYPIC SCREENING Gene(s) specific To new phenotype

MCR-1 EXAMPLE Positive phenotype Negative phenotype Ten colistin sensitive E. coli isolates from pigs in Denmark

MCR-1 EXAMPLE Positive phenotype Negative phenotype

MCR-1 EXAMPLE Positive phenotype Negative phenotype

MCR-1 EXAMPLE Positive phenotype mcr-1 2605 bp

Thank you To all my colleagues at Statens Serum Institut To all my former colleagues at DTU To my co-workers from the Danish Departments of Clinical Microbiology This work was supported by the Danish Ministry of Health and Prevention