Supporting Information

Similar documents
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

In Vitro Study of Receptor-Mediated Silica Nanoparticles Delivery across Blood-Brain Barrier

ApoTrack Cytochrome c Apoptosis ICC Antibody Kit

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Apoptosis And Anti-tumor Effect Induced By Mtor Inhibitor And Autophagy Inhibitor In Human Osteosarcoma Cells

Anti-HB-EGF (Human) mab

ApoTrack Cytochrome c Apoptosis ICC Antibody

ApoTrack Cytochrome c Apoptosis ICC Antibody Kit: 2 color immunocytochemistry of cytochrome c and mitochondria.

B. ADM: C. D. Apoptosis: 1.68% 2.99% 1.31% Figure.S1,Li et al. number. invaded cells. HuH7 BxPC-3 DLD-1.

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

THE BASICS OF IMMUNOHISTOCHEMISTRY

SANTA CRUZ BIOTECHNOLOGY, INC.

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

Supplementary Material

SUPPLEMENTAL MATERIAL. Supplemental Methods:

Engineering tumors with 3D scaffolds

1. Cross-linking and cell harvesting

SUPPLEMENTAL INFROMATION

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

Protocol(Research use only)

Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1

Cell viability. Cell viability was examined by MTT assay (Sigma-Aldrich).

Respiratory distress and early neonatal lethality in Hspa4l/Hspa4 double mutant mice

Supplementary Figure 1 A green: cytokeratin 8

1. Goat Anti-Caspase-3 (CPP32) Antibody, R&D systems (cat #AF-605-NA), 0.5ug/ml

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand

Rab5 Activation Assay Kit

Supplementary Fig.1 Luton

Supplementary Figure Legend

Cdc42 Activation Assay Kit

Lung Cell Apoptosis. Man Yi, Rosetta Belcastro, Samuel Shek, Daochun Luo, Martin Post, A Keith Tanswell ON-LINE DATA SUPPLEMENT

In general, 8- to 10-week-old adult females were ovariectomized and rested for 10 days

Technical Manual No Version

This Document Contains:

RheB Activation Assay Kit

Gα 13 Activation Assay Kit

Description of supplementary material file

At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in

Supplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein

TUNEL Apoptosis Detection Kit (Green Fluorescence)

Arf6 Activation Assay Kit

SUPPLEMENTARY INFORMATION

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.

TUNEL Universal Apoptosis Detection Kit (FITC-labeled)

Isolation, culture, and transfection of primary mammary epithelial organoids

For Research Use Only. Not for use in diagnostic procedures. Anti-NRF2 mab

2-step or indirect immunofluorescence 1. Substrate on which cells are plated: plastic vs. glass; coating vs. non

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5

Immunohistochemistry guide

Neural Stem Cell Characterization Kit

Supplemental Information

Supplementary Material - Methods

Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells

Sarker et al. Supplementary Material. Subcellular Fractionation

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION FIGURE 1 - 1

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

Histone H3 Methylation Antibody Panel Pack I - Active Genes Base Catalog # C Component Size Shipping Temperature

Supporting Information

Nature Immunology: doi: /ni.1744

Detection of antibody-stained cell surface and intracellular protein targets with the Agilent 2100 bioanalyzer. Application

Impairment of Alveolar Macrophage Transcription in. Idiopathic Pulmonary Fibrosis. Online Data Supplement

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Antibody was principally purchased from Santa Cruz (EGFR sc-03), Cetuximab (Bristol

ab BrdU Immunohistochemistry Kit

BrdU Immunohistochemistry Kit Instruction Manual

For in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic

bronchial epithelial cells (I). Bronchi are outlined with dashed line. Scale bars = 25 µm, if not

mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet

< Supporting Information >

Anti-p62 C-terminal pab

EdU Cell Proliferation Kit. User Manual

Spironolactone ameliorates PIT1-dependent vascular osteoinduction in klotho-hypomorphic mice

Hypoxyprobe -1 Green Kit Kit contents:

Tumor tissues or cells were homogenized and proteins were extracted using

Lentiviruses were produced by transfection with Effectene reagent of 10μg vector

TUNEL Universal Apoptosis Detection Kit ( Biotin-labeled POD )

Title: The cleaved FAS ligand activates the Na + /H + exchanger NHE1 through. Akt/ROCK1 to stimulate cell motility.

Supporting Information

PROTOCOL. Collagen I Thin Gel Coating of Alvetex Scaffold. Introduction. Method. Page 1

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplemental Information. Materials and methods.

Supplemental methods:

Western blotting technique: principle, procedure and application

ab TripleStain IHC Kit: M&M&R on human tissue (DAB, Red/AP & DAB/Ni)

Supporting Information

Immunofluorescence of organoids embedded in Basement Membrane Matrix

Hypoxyprobe -1 Pacific Blue Kit (HPI Catalog # HP15-XXX)

Hypoxyprobe -1 Pacific Blue Kit (HPI Catalog # HP15-XXX)

Supplementary Materials and Methods

How to run Alpha assay: How to setup an Alpha assay Make your own assay!

Hypoxyprobe Plus Kit

ab TripleStain IHC Kit: R&R&M on human tissue (DAB, AP/Red & Green/HRP)

Antibody Staining of Formaldehyde-fixed Worms by Gary Ruvkun and Michael Finney and Modified Finney- Ruvkun protocol

Promotion of HDF Cell Attachment and Proliferation

Whole Mount IHC Protocol

Supporting Information

Transcription:

Supporting Information Groschwitz et al. 10.1073/pnas.0906372106 SI Methods In vitro permeability. Caco2-bbe human intestinal adenocarcinoma cells (ATCC) were maintained in DMEM supplemented with 10% FCS, 0.1 mm nonessential amino acids, 1 mm sodium pyruvate, 10 mm Hepes, and 1 penicillin/streptomycin (all Invitrogen) in a humidified incubator (5% CO 2, 37 C). Cells (5 10 5 ) were seeded on snapwells (12-mm diameter, 0.4- m pore; Corning) and cultured for 18 21 days. TER was monitored with an EVOM/Endohm (Costar), only snapwells with TER 250 *cm 2 were used. Baseline TER was measured and recombinant human chymase (0.005 0.5 U/mL; Sigma) added to the basolateral chamber. TER was monitored over 24 h, with some snapwells placed in Ussing chambers after 30 min or 4 h of stimulation for permeability assays using FITC-dextran as described above. Additional snapwells were treated for 12 h with 0.05 U/mL chymase preincubated with the serine protease inhibitor chymostatin (100 M; Sigma) or vehicle (DMSO), and TER measured. Epithelial Cell Proliferation, Migration, and Apoptosis. Bromo-2 deoxyuridine (BRDU) in PBS was injected i.p. (0.2 mg/g body weight) and mice killed 24 h later. BRDU-labeled cells in the jejunum were detected using a BRDU staining kit (Zymed) per manufacturer s instructions. A minimum of 25 well-oriented, villus-crypt units were counted for BRDU cells to quantify proliferation. The distance from the crypt base to the farthest BRDU epithelial cell was measured for epithelial migration using ImageProPlus. Apoptotic cells were detected by cleaved caspase-3 immunohistochemistry (Cell Signaling). Immunofluorescence. Jejunum was fixed in 4% paraformaldehyde followed by 30% sucrose. Frozen sections were brought to room temperature for 30 min, permeabilized in ice-cold acetone for 10 min, and blocked in 5% goat serum per 1% BSA per 0.05% Triton-X-100/TBS. Sections were incubated with primary antibodies: rabbit anti-fibronectin (1:80, Millipore), rabbit anticlaudin-3 (1:25, Zymed), rat anti-e-cadherin (1:500, Zymed), rabbit anti-mcpt-1 or -4 [1:25, 1:250 (25)] or isotype control overnight at 4 C. After washing, slides were incubated with AlexaFluor 488-conjugated goat anti-rabbit or AlexaFluor 594 goat anti-rat secondary antibodies (1:250, Molecular Probes) for 90 min and coverslipped with DAPI/Supermount G. Caco2 Cell Immunofluorescence. Confluent Caco2-bbe cells grown on transwells were stimulated basolaterally with 0.05 U/mL human chymase for 0, 12, or 24 h. Cells were rinsed, fixed in 4% paraformaldehyde for 30 min on ice, permeabilized in 0.5% Triton-X-100/TBS for 10 min and blocked in 5% goat serum per 1% BSA per 0.05% Triton-X-100/TBS for 30 min. Cells were incubated with primary antibodies: rat anti-e-cadherin and rabbit anti-zo-1 (1:250, Zymed) for 2 h followed by AlexaFluor 488-conjugated goat anti-rabbit Ig or AlexaFluor 594 goat anti-rat Ig (1:250, Molecular Probes). Transwell filters were placed on slides and coverslipped with DAPI/Supermount G. Protein and RNA Analysis. Jejunum protein (30 g) was separated under reducing and denaturing conditions on 4 12% Bis-Tris gels and transferred to nitrocellulose membranes. Membranes were blocked in 5% milk per 0.1% Tween-20 per TBS for 2 h. Rabbit primary antibodies against actin (1:2,000, Sigma), claudins-1, -2, and -3 (1 g/ml, Zymed), and E-cadherin (1:1,000 Zymed), and a peroxidase-conjugated goat anti-rabbit Ig secondary antibody (1:10,000, Calbiochem) were used. Proteins were detected by chemiluminescence (ECL Plus, Amersham). Densitometric analysis was performed using Image J (National Institutes of Health). RNA analysis by quantitative real-time PCR was performed as described in ref. 1. Everted Gut Sac Method. Jejunal mucosal permeability to FITC- Dextran (FD4) was assessed using the everted gut sac method as described in ref. 2. Permeability was expressed as the mucosalto-serosal clearance of FD4 and fluorescence was determined by spectrophotofluorometry (Biotek). IgE-Mediated Passive Anaphylaxis. Mice were injected with 50 g anti-ige antibody [EM-95 (21)] or saline. Rectal temperature was monitored for 1 h and serum collected. Mcpt1 serum levels were measured by ELISA according to manufacturer s instructions (Moredun Scientific). Hydroxyproline Assay. Intestinal tissue was hydrolyzed overnight in 6 N HCl at 100 C. The supernatant was neutralized with 1% phenolphthalein and titrated against 10 N NaOH, then mixed with isopropanol and chloramine-t/citrate buffer solution (ph 6.0). Erlich s reagent was added and incubated for 25 min at 60 C then measured at 558 nm. Hydroxyproline levels were calculated using 4-hydroxy-L-proline (Calbiochem) as a standard. 1. Miller HR, Pemberton AD (2002) Tissue-specific expression of mast cell granule serine proteinases and their role in inflammation in the lung and gut. Immunol 105:375 390. 2. Wattanasirichaigoon S, Menconi MJ, Delude RL, Fink MP (1999) Effect of mesenteric ischemia and reperfusion or hemorrhagic shock on intestinal mucosal permeability and ATP content in rats. Shock 12:127 133. 1of6

Fig. S1. Decreased jejunal permeability to FD4 in Kit W-sh/W-sh (Wsh) and Mcpt4 / mice assessed by the everted gut sac method. Everted jejunum sacs were incubated in Krebs buffer containing FD4 and the mucosal-to-serosal clearance of FD4 was measured. Values represent mean SEM; n 5 12 per group. Statistical significance is: *, P 0.005 and **, P 0.001 vs. control. 2of6

Fig. S2. Mcpt4-deficiency does not alter homeostatic intestinal mast cells. (A) Chloroacetate esterase reactive mast cells in the jejunum of WT, Mcpt4 /, and Kit W-sh/W-sh (Wsh) mice were quantified per villus crypt unit (VCU) and localized to the villus, villus-crypt junction (V/C jxn), crypt, and submucosa. No positive cells were detected in the jejunum of mast cell-deficient Kit W-sh/W-sh mice. Values represent mean SEM of 100 VCUs per mouse; n 6 9 mice per group. (B) Immunofluorescent detection of Mcpt1 (green; Top) and Mcpt4 (green; Bottom) in the jejunum of WT (Left) and Mcpt4 / (Right) mice. Note the absence of Mcpt4 detection in Mcpt4 / jejunum (Bottom Right). Nuclei are shown by DAPI (blue). (C) Serum Mcpt1 measurement and (D) rectal temperature change ( Temp C) at 15 min in WT and Mcpt4 / mice after iv administration of 20 g anti-ige (EM-95) or control antibody. Values represent mean SEM; n 4 6 mice per group. 3of6

Fig. S3. Mast cell chymase alters intestinal epithelial permeability. Confluent Caco2-bbe cells cultured on snapwells were stimulated basolaterally with recombinant human chymase. (A) TER was measured from 0 to 24 h and expressed as a percentage of baseline TER (0 min) in the absence ( ) or presence (E) of 0.05 U/mL chymase. (B) Dose-response TER changes to chymase were determined at 12 h in the absence ( ) or presence ( ) of the serine protease inhibitor, chymostatin 100 M. (C and D) Apical to basolateral flux of FITC-dextran measured at 30 min (C)and4h(D) after 0 0.5 U/mL chymase stimulation. To confirm Caco2-bbe cellular integrity and viability, (E) confluent Caco2-bbe cells cultured on transwells were stimulated with human chymase for 12 (Middle) or24(right) h or with media alone as a control (Left) and E-cadherin (red) and ZO-1 (green) immunofluorescence was performed; nuclei stained by DAPI (blue). Values represent mean SEM; n 6 9 per group. Statistical significance is: (A) *, P 0.001 chymase vs. control; (B) *, P 0.05 and **, P 0.001 chymase vs. control and chymase vs. chymostatin; (D) *, P 0.05 low dose chymase (0.005 U/mL) vs. control and #, P 0.05 high dose chymase (0.5 U/mL) vs. control. 4of6

Fig. S4. Kit W-sh/W-sh and Mcpt4 / mice do not display altered intestinal apoptosis or proliferation. Apoptotic and proliferating cells in the jejunum of WT, Kit W-sh/W-sh (Wsh), and Mcpt4 / mice were quantified per villus crypt unit (VCU) and localized to the villus, crypt, and lamina propria. (A) Apoptotic cells were stained for cleaved caspase-3 and positive cells quantified per VCU. (B) Epithelial proliferation was measured by the incorporation of BRDU and quantified as BRDU cells per VCU. Values represent mean SEM; n 5 7 mice per group. 5of6

Fig. S5. Mast cell- and Mcpt4-deficiency does not alter the intestinal extracellular matrix. (A and B) Collagen and fibronectin expression were examined in the jejunum of WT, Kit W-sh/W-sh (Wsh), and Mcpt4 / mice. (A) Collagen was examined by Trichrome staining (blue, Left) and by quantification of (B) hydroxyproline in the small intestine. (A) Fibronectin was analyzed by immunofluorescence (green, Right) with nuclei shown by DAPI (blue). Values represent mean SEM; n 5 7 mice per group. 6of6