Supplemental Data. Gómez et al. (2009). The maize transcription factor MRP-1 (Myb-Related-Protein-1) is a key regulator of the differentiation of transfer cells. Supplemental Figure 1. Expression analyses of the AL-9 gene. A, the promoter of the AL-9 gene directs the expression of the GUS reporter to the aleurone layer (at 25 DAP in the image). Note that the promoter activity labels the upper, adgerminal and abgerminal sides of the aleurone (Al) but it is excluded from the basal endosperm transfer layer (BETL). B, An antisense AL-9 probe labels the aleurone cells at the abgerminal side of the kernel, in this case at 16 DAP. Cells of the BETL do not express AL-9 and the expression of the BETL marker BETL-9 (C) is perfectly complementary to that of AL-9. SE, starchy endosperm; Em, embryo; PCH, placento-chalaza. Bars indicate 4 mm in A and 300 μm in B and C. 1
Supplemental Figure 2. Interpretation of the transformation of endosperm epithelial cells into transfer cells, induced by the expression of MRP-1. The basal membrane of this epithelium is indicated by a green bar. The figures are orientated so that the upper and basal sides of the endosperm coincide with the upper and lower sides of the diagram. The aleurone layer (A, gray cells) covers all the endosperm surface except for the basal part, where cells facing the maternal phloem terminals differentiate into several layers of TCs (C, dark blue cells). The BETL cells are longer than aleurone cells and appear densely covered by CWIs, especially, but not only, on the basal side. The expression of MRP-1 at the abgerminal region of the aleurone (B) transforms aleurone cells into TCs (light blue), which are also elongated and develop CWIs, although to a lesser extent than in the cells of the BETL. The yellow cells in A, B and C represent starchy endosperm cells; these are round and much larger than the epithelial cells due to the endo-reduplication process they undergo. 2
Supplemental Figure 3. The ectopic expression of MRP-1 induces the expression of BETL-1. Immunodetection of BETL-1 (black color, greyish in areas that accumulate less protein) in both the BETL (A) and the EETL (B) in a 12 DAP transgenic seed. BETL-1 is produced in the transfer cells and EETL, and also accumulates, although to a lesser extent than BETL-2, in the adjacent maternal tissue. Pd, pedicel. Bars indicate 50 μm. 3
Supplemental Figure 4. Reduced expression of MRP-1 in the abgerminal aleurone at 17 DAP. A, B, Expression analyses of MRP-1 in the abgerminal region of 17 DAP transgenic (A) or non-transgenic (B) sibling kernels using a MRP-1 antisense probe. The bright spots concentrating at the external cell layer in A indicate accumulation of the transcript in the otherwise morphologically normal aleurone cells. The expression level is reduced as compared with that observed at earlier developmental stages; compare A with Figure 1C and Figure 1D in the manuscript. Bars denote 50 m. 4
Supplemental Figure 5. Morphological analysis of the mature endosperm epidermis. ProAL-9:MRP-1 transgenic (A, B, C) and non-transgenic (D, E, F) mature kernels were imbibed for 72 hours, fixed and wax-embedded. A, D, The transfer cell layer (TCL) appears to be nearly obliterated between the embryo (Em) and the placentochalaza (PCH) in all cases. B, E, the abgerminal aleurone (Al) showing slightly elongated aleurone cells. C, F, Images of the upper part of the kernel with a typical aleurone layer formed by a single layer of cubic cells. Sections were stained with azure-b. P, pericarp; SE, starchy endosperm. Bars indicate 500 μm. 5
Supplemental Figure 6. The presence of the MRP-1 coding sequence decreases the expression efficiency of reporter constructs in transient expression experiments. ProAL-9:GUS (A, C), ProAL-9:MRP1:GUS (B, D) or ProMRP-1:GUS constructs (E) were used to transiently transform sagitally dissected 10 DAP maize kernels (A, B) or the abaxial surface of immature V. faba cotyledons (C, D, E) by particle bombardment. Tissues were then histochemically assayed for GUS activity. Experimental details: Comparisons were made of the expression of constructs containing either the GUS reporter gene or a fusion MRP-1:GUS coding sequence (both under the control of the AL- 9 promoter) in biolistically-transformed 10 DAP maize kernels. As expected, the ProAL- 6
9:GUS construct labeled the aleurone layer intensively and exclusively (mean number of spots per section 7.35±0.92) in sagittally dissected maize kernels (A). The construct expressing the fusion protein MRP-1:GUS from the AL-9 promoter produced significantly fewer spots per kernel (1.2±0.57, B), but again, exclusively in the aleurone cells. These results suggest that the presence of the MRP-1 coding sequence reduces either the stability or the translation of the whole MRP-1:GUS transcript in aleurone cells. Alternatively, this particular construct might not be efficiently expressed (a non-obvious design problem), or the fusion protein it encodes might have reduced enzymatic activity compared to the GUS protein alone. To test these possibilities, both constructs were introduced into the abaxial epidermis of Vicia faba cotyledons by biolistic bombardment. The abaxial epidermis consists of TCs (Offler et al., 1997; Weber et al., 1997) able to express the MRP-1 promoter (E) but also the AL-9 promoter (albeit at a lower level) (compare C and D with E). In this system, ProAL-9:GUS (C) and ProAL-9:MRP-1:GUS (D) produced equivalent results in terms of the number of spots per section, and both constructs yielded a similar spotting pattern to that obtained with the promoter of MRP-1 fused to the reporter gene (E). This indicates that the ProAL-9:MRP-1:GUS construct is efficiently processed and translated into an active GUS protein in cotyledon epithelial TCs capable of expressing the MRP-1 promoter (which has been shown to be TC-specific [Barrero et al., 2009]). 7
Supplemental Figure 7. Expression analyses in miniature-1 and wild-type kernels Real time RT-PCR expression analyses of MRP-1, the transfer cell specific gene BETL-1 and the aleurone marker AL-9 in RNA extracted from miniature-1 mutant kernels (min-1) or wild-type kernels (WT) at the indicated developmental stages. Relative expression levels refer to the expression level of BETL-1 in wild-type kernels at 11 DAP. Values are means + SD of two technical replicates. 8
Supplemental Figure 8. Expression pattern of the aleurone marker gene AL-9 in young kernels. A, B, wild-type maize seed sections at 3 DAP (A) or 6 DAP (B) were reacted with an antisense riboprobe for AL-9. Note the absent (A) or weak (B) hybridization signals obtained with this aleurone-specific marker on the abgerminal side of the endosperm. AB, abgerminal, Em, embryo; BETL, basal endosperm transfer cell layer. Bars denote 0.5 mm in A and 1 mm in B. 9
Supplemental Figure 9. A model explaining how maternal signals might be perceived by the abgerminal side of the endosperm during its initial developmental stages. The picture shows the immunolocalization of the BETL-2 protein in a 6 DAP wild-type kernel. The protein is localized in the future TC layer and the corresponding area of the placento-chalaza (brown color). TC development is induced at the base of the endosperm by the expression of MRP-1 (this work), very likely in response to direct induction by maternally produced signals (yellow arrows). A large area of the basal part of the nucellus is exposed to products (red arrows) released from the phloem terminals 10
(Ph), and might therefore influence the development of the abgerminal side of the endosperm. Note that the germinal side would not perceive these hypothetical signals. The subsequent growth of the endosperm crushes the nucellus cells and allows the endosperm to completely occupy the basal part of the kernel by 10-12 DAP; the exposure of the abgerminal side of the endosperm to maternally-derived products would therefore cease. Bar indicates 1mm. 11
Supplemental Table 1. Oligonucleotides used for quantitative RT-PCR. Gene Amplicon size (bp) MRP-1 120 BETL-1 93 BETL-2 115 BETL-10 76 TCRR-1 106 INCW-2 114 AL-9 283 ESR-6 90 FKBP-66 117 Primers (5-3 ) GACTACAGATGAGCACAG*GAATTTC GCATGGCTAGAGATCTGCA CAGCACAATCGTCGCGCTT TTCTTGGGTTTCCCGATGC*AGC TGCACGCACAACAAGTG*GGC AGCATGGCCCGTCGTCATT TCCTTGTGGCCTATCGT*GCG GCTCATGCATGGGCCGTGAT ATTGGAATTCTTAGATGCG*AAC CGATTC*CTTCACTTCCCTAA GACCCTACCAA*GTCGTCCCTGA CGACCGGTCGA*TCAGGCTTC CTATGTTTGCCATAGGCTCTCATGC GCTGGAACCTTGTAGC*TTCCG GCCATAACCATGCCGTCCT TGCAGACGCATCCATTC*CGA GGGTGCTGTTGTTGAAG*TCA GCAATAA*CTTCCTCTTCATCG Expression domain Transfer cells Transfer cells Transfer cells Transfer cells Transfer cells Transfer cells Aleurone Embryo surrounding region Ubiquitous The sequences of the sense and antisense oligonucleotides are indicated along with the size of the resulting amplicon and the target expression domain of the marker. The asterisks denote the position site of introns in the corresponding genomic sequences. 12