A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet

Similar documents
Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping

Usp14 EPD0582_2_G09. EUCOMM/KOMP-CSD Knockout-First Genotyping

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

SUPPLEMENTARY INFORMATION

TRANSGENIC TECHNOLOGIES: Gene-targeting

Theoretical cloning project

TITLE: Mammary Specific Expression of Cre Recombinase Under the Control of an Endogenous MMTV LTR: A Conditional Knock-out System

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1

Materials and Methods

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

Table S1. List of primers used in this study

Supplementary Figure 1. Isolation of GFPHigh cells.

CRISPR/Cas9 Mouse Production

Lecture Four. Molecular Approaches I: Nucleic Acids

BS 50 Genetics and Genomics Week of Nov 29

Concepts: What are RFLPs and how do they act like genetic marker loci?

Fatchiyah

SUPPLEMENTAL MATERIALS

Construction of plant complementation vector and generation of transgenic plants

Recombinant DNA Technology

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Recombinant DNA Technology

Supplemental Data. Chromosomal Translocation Mechanisms. at Intronic Alu Elements in Mammalian Cells

Alternative Cleavage and Polyadenylation of RNA

C-type natriuretic peptide signalling and cardiovascular disease Adrian Hobbs

Use of Gene Editing Technologies in Rodents. Carlisle P. Landel, Ph.D.

Transgenic mice Authors: Megha Kaushik and Archana Rao

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive

A tool kit for rapid cloning and expression of. recombinant antibodies

Biotech Applications Nucleic acid therapeutics, Antibiotics, Transgenics. BIT 220 End of Chapter 22 (Snustad/Simmons)

7 Gene Isolation and Analysis of Multiple

Chapter 9 Genetic Engineering

Bacterial DNA replication

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Supplementary Figure 1

The V-ATPase B1-subunit promoter drives expression of Cre recombinase in intercalated cells of the kidney

SUPPLEMENTARY INFORMATION

Supplemental Fig. S1. Key to underlines: Key to amino acids:

Chapter 20: Biotechnology

CRISPR Applications: Mouse

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Multiplex Assay Design

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

FIG S1: Calibration curves of standards for HPLC detection of Dopachrome (Dopac), Dopamine (DA) and Homovanillic acid (HVA), showing area of peak vs

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection

The Use of Genetically-Modified Mouse Models to Study the Actin Cytoskeleton

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Supplementary Information

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping

Using mutants to clone genes

Supplemental Information

Genetics Lecture 21 Recombinant DNA

Tsai et al., Supplemental Tables. Table 1. Female reproductive defects in Hurp -/- mice

7.013 Practice Quiz

Supplementary Figures Montero et al._supplementary Figure 1

Supplementary Fig. S1. Schematic representation of mouse lines Pax6 fl/fl and mrx-cre used in this study. (A) To generate Pax6 fl/ fl

Genome editing. Knock-ins

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING

2054, Chap. 14, page 1

Color-Switch CRE recombinase stable cell line

MHC Region. MHC expression: Class I: All nucleated cells and platelets Class II: Antigen presenting cells

Supporting Online Material for

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No

SUPPLEMENTARY INFORMATION

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids.

Figure S1. gfp tola and pal mcherry can complement deletion mutants of tola and pal respectively. (A)When strain LS4522 was grown in the presence of

John Gurdon was testing the hypothesis of genomic equivalence or that when cells divide they retain a full genomic compliment.

Genomes summary. Bacterial genome sizes

Large scale genome editing for. Senior Scientist, GenScript

Gene Expression Technology

Molecular Biology: DNA sequencing

In this protocol, DNA Strider for Mac is used for demonstration. The design of oligos for deleting Adephagia gp73 is used as an example.

Bioinformatics Support of Genome Sequencing Projects. Seminar in biology

Rapid confirmation of gene targeting in embryonic stem cells using two long-range PCR techniques

Cisgenics, Intragenics and Site-specific Mutagenesis

Supplementary Materials

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score

B6 Albino Mouse Models

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

Learning Objectives :

Cassette denotes the ORFs expressed by the expression cassette targeted by the PCR primers used to

Application Note: Generating GFP-Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors

SALSA MLPA probemix P155-D1 Ehlers-Danlos syndrome III & IV

Structural variation. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona

A Level. A Level Biology. DNA Technology Questions. AQA, OCR, Edexcel. Name: Total Marks: Page 1

Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR

Chapter 5. Genetic Models. Organization and Expression of Immunoglobulin Genes 3. The two-gene model: Models to Explain Antibody Diversity

Supplemental Information

Transcription:

A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary density (AU) GV [AU]: 9. [mmhg]: 9 80 0 0 7 8 9.9. 7..8 9... 0 # LSD HSD * * 0 0 # 00 0 0 0 Control mf-c Control mf-c 0 (mmhg) Supplemental Figure : Panels (A-D) Whole mount stainings of lymph capillaries (anti-lyve- antibody) in ears of FVB mice fed LSD or HSD, with and without mf-c treatment. Red square is the computerized quantitated area; numerical value is lymph-capillary density (arbitrary units) which is given together with mean arterial blood pressure (; mmhg) for each individual animal. (E) Lymph-capillary density in ear and mean arterial blood pressure () in the mice.

VEGFR Prox- Anti-VEGFR C E B D F WT A K-FLT Supplemental Figure : Lymph capillaries in kidneys in wild type mice (WT) and in mice with expression of soluble VEGFR under the control of the keratinocyte receptor (K-FLT mice). Green: VEGFR reporter fluorescence in wt and K FLT mice (Panels A and B); red: Prox- reporter fluorescence expression in WT and in K-FLT (Panels C and D). Panels E and F: anti-vegfr staining (brown) of renal lymph vessels in the same mice. In contrast to the hypoplastic lymph vessels in the skin, K-FLT mice showed normal lymph vessels in the kidney.

Supplemental Table : Differences in Na + concentration and osmolality between plasma and microdialysate from skin interstitium in rats. LSD: low salt diet, HSD: high salt diet. LSD (n=0) HSD (n=0) a) Na + concentration (mmol/l) Plasma 0.8±8. 8.±. Microdialysate 9.±8. 9.±9.0 P value (LSD versus HSD) plasma: 0.; microdialysate: 0.9 b) Osmolality (mosmol/kg) Plasma 09.±7.9 0.±0. Microdialysate.±.7.7±8.8 P value (LSD versus HSD) plasma: 0.; microdialysate: 0.7 P value (plasma versus microdialysate) LSD: 0.0 HSD: <0.00 LSD: 0. HSD: 0.0

A WT -probe 9. kb Long Arm of Homology (. kb) 9. kb loxp_fo loxp_re Short Arm (. kb) int. probe Target Region ( bp) Targeting construct Neo recombined -probe.7 kb loxp_fo Neo. kb int. probe loxp_re B C appr. kb loxp FRT Supplemental Figure. Generation of TonEBP-floxed mice. Panel A. Targeting Strategy. TonEBP-floxed mice were generated by ingenious Targeting Laboratory, Inc. (00 Smithtown Avenue, Ronkonkoma, NY 779) using standard gene-targeting techniques. The targeting construct was designed such that the short homology arm extends about. kb to exon, whereas the long homology arm extends about. kb to exon. A single loxp-site, containing an engineered -site for Southern Blot analysis, was inserted bp upstream of exon and a loxp/frt-flanked Neo cassette was inserted 0 bp downstream of exon. Thus the target region is bp long and includes exon. The figure is not exactly drawn to scale! BA (C7BL/ x 9/SvEv) hybrid embryonic stem cells were electroporated with 0µg of linearized targeting vector and selected with G8 antibiotic. Panel B. Screening and analysis of the retention of the third loxp-site. (Initial Screening was carried out by PCR, using reverse primer -ACGCCAGTGTCATGTTGTTG- downstream of the short arm and forward primer - GCATAAGCTTGGATCCGTTCTTCGGAC- within the Neo cassette generating a product of.7 kb in case of homologous recombination; data not shown). Four PCR-positive clones were expanded (indicated by an x) and retention of the third loxp-site upstream of exon was proven by PCR with primers -GTAACCATGATTAGTCTTTTAGCTTTATG- and - GTTCTGAGAATCCAAAGCACAAC- generating a bp long fragment from the WT-allele and an additional 9 bp long fragment from the floxed allele. Panel C. Southern Blot analysis. Further confirmation of the expanded homologous recombinant clones was performed by two different Southern Blot experiments. Left panel: -digested DNA was hybridized with a 7 bp long probe (probe primers: - TTTTGTGGCTAAGCACAGTCCC- and -CATACTGCAGCTCTGCTCAGATTC- ), which was targeted against the external region, detecting a 9. kb long WT-fragment and the.7 kb long floxed fragment. Right panel: -digested DNA was hybridized with a bp long probe (probe primers: -TGACTGCCCTCAACAGTTCATTTG- and -ATTCAGGATCTGCTACCACCACTG- ) targeted against the internal region, detecting a 9. kb long WT- and the. kb long floxed fragment. In both Southern Blot experiments, DNA from C7Bl/ (B), 9/SvEv (9), and BA (C7Bl/ x 9/SvEv; Hyb) mouse strains were used as wild type controls. Confirmation of Neo-deletion and standard Genotyping procedures. Targeted itl BA (C7BL/N x 9/SvEv) hybrid embryonic stem cells were microinjected into C7BL/ blastocysts. Resulting chimeras with a high percentage agouti coat color were mated to C7BL/ homozygous FLP mice to remove the Neo cassette. Primers Ndel ( -GTTGTGCTTTGGATTCTCAGAAC- ) and Ndel ( -CTTCTACCCTTCTATTTCAGGAAGC- ) were used to confirm Neo-deletion indicated by a 7 bp fragment. DNA still containing Neo is not amplified since the fragment would be too long. The same primer pair also generates a 97 bp long WT-fragment. Thus it can be routinely applied for standard genotyping. Genotyping primers are not depicted within the figure.