DNA Structure and Replica2on
Structure of DNA James Watson and Francis Crick (with Maurice Wilkins) awarded the Nobel Prize in 1962 for the construc2on of the double helix model of DNA Rosalind Franklin used X- ray crystallography to produce an image of the double helix model of DNA
DNA Structure Made of Nucleo<des 3 parts: 1. Phosphate group 2. Sugar (deoxyribose) 3. Nitrogen base *Two Nitrogen bases that bind together form a base pair DNA keeps its structure with a sugar (deoxyribose) & phosphate backbone
DNA Deoxyribonucleic Acid Contains your genes { Genes are sec2ons of DNA that code for a certain trait (hair color, height, nose shape ) Double stranded in the form of a double helix (twisted ladder) Contains four nitrogen bases, phosphate and deoxyribose
4 Nitrogen Bases Purines (2 rings) { Adenine { Guanine (PUGA2) Pyrimidines (1 ring) { Thymine { Cytosine DNA Nitrogen Bases
Chargaff s Rules of Base Pairing Adenine (A) always binds with Thymine (T) { Two hydrogen bonds Guanine (G) always binds with Cytosine (C) { Three hydrogen bonds
Write the Complimentary DNA Strand ATGCGGATACATCCGATCGATGCAATCATGACATA TGACGGACACTTACAGATTCTGTGAGTCTCAACGG GAGCATTAGCAGGACTGCACGATATTGTCCTAGTA GTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTA
DNA Replication Definition: process that copies the entire genome (all of the DNA) of a cell In humans, your cells will replicate 3 billion nucleotides in 6 hours! 8
Replication Facts DNA has to be copied before a cell divides Occurs in the nucleus of eukaryotic cells DNA is copied during the S or synthesis phase of interphase Remember, each of the 2 new cells made during Mitosis will need identical DNA strands at the completion of the cell cycle 9
Synthesis Phase (S phase) S phase during interphase of the cell cycle Nucleus of eukaryotes DNA replication takes place in the S phase. S phase G 1 interphase G 2 Mitosis -prophase -metaphase -anaphase -telophase 10
Barbara McClintock is credited for the discovery of the replica2on process. She was awarded the Nobel Prize for her work in 1983. 11
DNA Replication STEP 1 The enzyme Helicase unwinds and separates the 2 DNA strands by breaking the weak hydrogen bonds between the nitrogen bases HELICASE 12
The two DNA strands open forming Replication Forks (Y-shaped region) 3 5 3 Parental DNA Molecule Replication Fork 5 13
As the DNA strand opens at the replication forks, Replication Bubbles form Eukaryotic DNA will have MANY replication bubbles Prokaryotes (bacteria) have a single bubble Bubble Bubble Bubble 14
REPLICATION STEP TWO Complementary nucleo2des are added to each strand by the enzyme DNA Polymerase New replica2on bubbles form un2l the en2re strand is replicated. DNA polymerase also proofreads the DNA errors, hopefully catching most of them 15
Proofreading New DNA DNA polymerase initially makes about 1 in 10,000 base pairing errors DNA Polymerase proofreads and corrects these mistakes The new error rate for DNA that has been proofread is 1 in 1 billion base pairing errors 16
REPLICATION STEP 3 * The enzyme Ligase attaches all the replication bubble fragments together. * The new double helixes are identical- each contains one original template strand and one copied strand * Replication is semiconservative since each new DNA molecule is made of one old strand and one new strand. 17
Semi-conservative Model of Replication Idea presented by Watson & Crick The two strands of the parental molecule separate, and each acts as a template for a new complementary strand New DNA consists of 1 PARENTAL (original) and 1 NEW strand of DNA Parental DNA Strands DNA Template Strand New DNA Strand New DNA Strand DNA Template Strand 18
SUMMARY OF REPLICATION STEPS ONE MORE TIME: DNA is unwound with the help of the enzyme Helicase. It separates the hydrogen bonds between the nitrogen bases. Each original strand of nucleo2des acts as a template (paaern) to make a new chain The new strand is assembled as DNA polymerase matches free- floa2ng nucleo2des w/complementary nitrogen bases in the replica2on bubble DNA ligase links together the individual replica2on bubbles. 19
ENZYME FUNCTION Helicase Unwinds helix by breaking hydrogen bonds between nitrogen bases DNA Polymerase Ligase *Builds new strands inside replication bubble by attaching nucleotides to their complementary base *Proofreads for mistakes Forms bonds between replication bubbles so DNA can return to the helical form. 20
DNA Replica2on BIG IDEA DNA is replicated during S- phase of interphase Semiconserva,ve replica,on produces two copies of DNA, each containing one original strand and one new strand The end result of DNA replica2on is two iden2cal strands of DNA (half old and half new)
DNA Damage & Repair Chemicals & ultraviolet radiation damage the DNA in our body cells Cells must continuously repair DAMAGED DNA DNA polymerase and DNA ligase work together to help replace damaged DNA and bond the new nucleotides together 22