AP Biology Day 34. Monday, November 14, PDF Free Download

AP Biology Day 34 Monday, November 14, 2016

Essen%al knowledge standards 3.A.1: DNA, and in some cases RNA, is the primary source of heritable informa%on 3.A.1.e: Gene%c engineering techniques can manipulate the heritable informa%on of DNA and, in special cases, RNA Electrophoresis Plasmid-based transforma%on Restric%on enzyme analysis of DNA Polymerase Chain Reac%on (PCR)

I will be able to: FLT describe the func%on of restric%on enzymes and explain how they are used in recombinant DNA technology Outline the procedures for cloning a eukaryo%c gene in a bacterial plasmid Explain how gel electrophoresis is used to analyze nucleic acids and to dis%nguish between two alleles of a gene By comple1ng Ch. 20 Lecture Notes

Ch. 20: Biotechnology

What is biotechnology? Biotechnology uses living organisms or their gene%c content to make useful products, such as GMOs 5

Overview Sequencing of the human genome was completed by 2007. DNA sequencing has depended on advances in technology, star%ng with making recombinant DNA. 6

I. Recombinant DNA A. Def. Nucleo4de sequences from two different sources are combined in vitro into the same molecule In vitro refers to a process that occurs outside of a body/cell (in an ar%ficial medium) 7

I. Recombinant DNA B. Gene%c engineering = direct manipula4on of genes via biotechnology 8

I. Recombinant DNA C. Biotechnology = manipulates living organisms or their gene4c content to make useful products, such as GMOs 9

II. Strategies of Gene Manipula%on A. Recombinant DNA and Cloning B. Amplifying DNA in Vitro 10

A. Recombinant DNA and Cloning 1. Plasmids 2. Gene Cloning 3. Eukaryo%c Gene Cloning in a Bacterial Plasmid 11

1. Plasmid Plasmids = small circular DNA molecules that replicate separately from the bacterial chromosome. This makes them useful to scien%sts to clone, transfer, and manipulate genes! They can insert pieces of DNA (genes) into a plasmid, and then have the bacterium replicate the gene rapidly! Cloned genes are useful for making copies of a par%cular gene and producing a protein product. 12

Recombinant DNA Plasmid & Gene Cloning Bacterium Bacterial chromosome Plasmid 1 Recombinant DNA (plasmid) Gene inserted into plasmid 2 Gene of interest Plasmid put into bacterial cell Cell containing gene of interest DNA of chromosome Recombinant bacterium 3 Host cell grown in culture to form a clone of cells containing the cloned gene of interest Gene of Interest Protein expressed by gene of interest Copies of gene Protein harvested Basic research on gene 4 Basic research and various applica4ons Basic research on protein Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart aqack therapy Human growth hormone treats stunted growth

2. Gene Cloning a. Restric%on Enzymes b. Restric%on Sites c. Restric%on Fragments d. S%cky Ends e. DNA ligase f. Cloning Vector 17

Bacteria cells produce restric%on enzymes as a defense against bacteriophages BamHI: Bacillus amyloliquefaciens HindIII: Haemophilus influenza Where do we get restric%on enzymes?

2. Gene Cloning a. Restric%on Enzymes (RE s) = cut DNA molecules at specific DNA sequences called restric4on sites. b. Restric%on Sites = specific base pair sequence recognized by restric4on enzymes 19

An enzyme that cuts DNA at a specific site (sequence) Blunt Ends Sticky Ends What is a restric%on enzyme?

2. Gene Cloning a. Restric%on Enzymes (RE s) b. Restric%on Sites Specific enzymes cut at specific sequences 21

Eye Racecar Never odd or even What is a palindrome? 22

Cut at Palindromes: the complimentary DNA is a palindrome to the DNA strand Palindromes: Same forwards/backward: A nut for a jar of tuna Eva, can I stab bats in a cave? How do restric%on enzymes cut?

2. Gene Cloning c. Restric%on Fragments A restric4on enzyme usually makes many cuts, yielding restric4on fragments. 25

d. S%cky Ends 2. Gene Cloning Both the plasmid DNA and gene of interest should be cut with the same restric4on enzyme(s) in order to create complementary s4cky ends 26

e. DNA ligase 2. Gene Cloning a. Seals the (covalent) bonds between restric4on fragments 27

f. Cloning Vector 2. Gene Cloning Original plasmid = the cloning vector = a DNA molecule that can carry foreign DNA into a host cell and replicate there. 28

Cloning vector plasmid Engineered to replicate in high numbers within bacteria Expression vector plasmid Carries the gene of interest in a specific loca%on that allows the bacteria to express the gene Plasmids

Cloning Vector plasmid Contains: 1. Origin of replica%on 2. Selectable marker gene 3. Mul%ple cloning site

To Make Recombinant DNA DNA 5ʹ 3ʹ Restric4on site 3ʹ 5ʹ 1 Restric4on enzyme cuts sugar-phosphate backbones. S4cky end 2 DNA fragment added from another molecule cut by same enzyme. Base pairing occurs. 3 DNA ligase seals strands. One possible combina4on Recombinant DNA molecule

TECHNIQUE Cloning Recombinant Genes Bacterial cell lacz gene Hummingbird cell amp R gene Bacterial plasmid Restric4on site S4cky ends Gene of interest Hummingbird DNA fragments Nonrecombinant plasmid Recombinant plasmids Bacteria carrying plasmids RESULTS Colony carrying nonrecombinant plasmid with intact lacz gene Colony carrying recombinant plasmid with disrupted lacz gene One of many bacterial clones

3. Eukaryo%c Gene Cloning in a Bacterial Plasmid a. Isola%on of DNA and plasmid b. Treatment with the same restric%on enzyme c. Mix foreign DNA with plasmids d. Addi%on of DNA ligase e. Introduc%on of new plasmid into bacterial cells 34

B. Amplifying DNA in Vitro 1. Polymerase Chain Reac%on = PCR = produces many copies of a specific segment of DNA Each cycle heats, cools, and replicates DNA to produce iden4cal DNA molecules at an exponen4al rate 37

PCR TECHNIQUE 5ʹ 3ʹ Target sequence Genomic DNA 3ʹ 5ʹ 1 Denatura4on 5ʹ 3ʹ 3ʹ 5ʹ 2 Annealing Cycle 1 yields 2 molecules Primers 3 Extension New nucleo- 4des Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence

DNA cloning allows researchers to Compare genes and alleles between individuals. Locate gene expression in a body. Determine the role of a gene in an organism. Several techniques are used to analyze the DNA of genes: Gel Electrophoresis, restric1on fragment analysis, Southern blogng, DNA sequencing. 40

III. DNA Technology and the Study of Genes A. Gel Electrophoresis B. Restric%on Fragment Analysis C. Gene%c Engineering 41

A. Gel Electrophoresis One indirect method of rapidly analyzing and comparing genomes is gel electrophoresis. This technique uses a gel as a molecular sieve to separate nucleic acids or proteins by size. A current is applied, and charged molecules move through the gel and are sorted into bands by their size 42

Gel Electrophoresis TECHNIQUE Mixture of DNA molecules of different sizes Cathode Power source Anode + 1 Gel Power source + Longer molecules 2 Shorter molecules RESULTS

Gel Electrophoresis Once you run a gel, you can visualize the DNA bands You can use a DNA ladder/marker to determine the base pair lengths We can then use this data to create a restric%on map 46

Example Let s say the enzymes BglII and BstEII together produce two fragments of 6008 and 1658 base pairs 47

EcoRV cuts twice: 4729 & 2937 segments 48

If EcoRV and BgIII are put together We get three fragments: 4729, 1992, and 945 bps So BglII must have made a cut between the first and second EcoRY segments 49

Key When making a restric%on map, it some%mes helps to first start with cuts made by one restric%on enzyme, then adding other enzymes as you go 50

B. Restric%on Fragment Analysis = DNA fragments produced by restric4on enzyme diges4on of a DNA molecule are sorted by gel electrophoresis. Restric%on fragment analysis is useful for comparing two different DNA molecules, such as two alleles for a gene. The procedure is also used to prepare pure samples of individual fragments. 51

B. Restric%on Fragment Analysis RFLP = Restric4on fragment length polymorphism = differences in restric4on fragment lengths in individuals Can be used as molecular markers Each individual will have unique DNA and their restric%on fragments will be unique as well By running a gel, we can create a DNA fingerprint, which are olen used in forensic science Can also be used as markers to iden%fy par%cular groups of people at risk for certain gene%c disorders 52

Restric1on Fragment Analysis Normal β-globin allele Normal allele Sickle-cell allele 175 bp 201 bp Large fragment DdeI DdeI DdeI DdeI Sickle-cell mutant β-globin allele Large fragment DdeI 376 bp DdeI Large fragment DdeI 201 bp 175 bp 376 bp (a) DdeI restric4on sites in normal and sickle-cell alleles of β-globin gene (b) Electrophoresis of restric4on fragments from normal and sickle-cell alleles

C. Gene%c Engineering 2. Stem cells A stem cell is a rela%vely unspecialized cell that can reproduce itself indefinitely and differen%ate into specialized cells of one or more types. Stem cells isolated from early embryos at the blastocyst stage are called embryonic stem cells; these are able to differen%ate into all cell types. The adult body also has stem cells, which replace nonreproducing specialized cells. 57

Review Vector DNA fragments from genomic DNA or cdna or copy of DNA obtained by PCR Cut by same restric4on enzyme, mixed, and ligated Recombinant DNA plasmids

Fig. 20-UN4 5ʹ 3ʹ TCCATGAATTCTAAAGCGCTTATGAATTCACGGC AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG Aardvark DNA 3ʹ 5ʹ A A T T G C A Plasmid

Restric4on Enzyme: Hind III --> Restric4on Fragments / S4cky Ends

Pair-Share-Respond 1. If you want to clone a gene using a bacterial plasmid, what steps would you take? 2. Why must plasmids and the gene of interest be cut with the same restric4on enzymes? 3. What are the three parts of PCR and what does PCR produce? 4. Explain the use of gel electrophoresis

CW/HW Finish notes FRQ Lab 2A Ques%ons 62

AP Biology Day 34. Monday, November 14, 2016