Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice A cohort of 18 chimaeras was generated from blastocyst injection of triple targeted ES cells (carrying loxp sites in MLL and ENL genes and a Cre knock in of LMO2). The rate of leukaemia incidence is plotted (A) in comparison to the rate of incidence in a previously published cohort of translocator mice (B) made by breeding germline carriers of the three alleles (reference 9, main text). The level of chimaerism (C) was estimated from coat colour (the ES line was of 129/Sv mouse origin and injected into C57/Bl6 mouse blastocysts). No correlation between chimaeric level and tumour rate was possible; in our original paper using the MLL-AF9 knock-in mouse (reference 10, main text), the time to leukaemia incidencedid not correlate with coat colour chimaerism.
A. LH homology Venus-Luciferase P1 EF-BOS promoter P2 RH homology arm of Mll Stop ATG frt arm of Enl B. } 10 20 30 40 50 TATGCAGTTGCTCTCCAGCGGTTCCATCTTCCAGCGGATAGAATGGCGCC ATACGTCAACGAGAGGTCGCCAAGGTAGAAGGTCGCCTATCTTACCGCGG H L Q E G A T G D E L P Y F P A 60 70 80 90 100 GGGCCTTTCTTTATGTTTTTGGCGTCTTCCATGGATCCACTAGGGCCGCT CCCGGAAAGAAATACAAAAACCGCAGAAGGTACCTAGGTGATCCCGGCGA P G K K I N K A D E M Luciferase coding <------------ <---------------frt site------- 110 120 130 140 150 CTAGAACTAGTGGATCTGAGAAGTTCCTATACTTTCTAGAGAATAGGAAC GATCTTGATCACCTAGACTCTTCAAGGATATGAAAGATCTCTTATCCTTG end of EF-BOS promoter <------------ --> 160 170 180 190 200 TTCAGATCCCCCGGGCTGCAGGAATTAATTCCTCACGACACCTGAAATGG AAGTCTAGGGGGCCCGACGTCCTTAATTAAGGAGTGCTGTGGACTTTACC Supplementary Fig. 4. Sequence of the genomic PCR product after FLP-mediated deletion CHO cells were transfected with cassettes 1 and 2 (Fig. 7) plus PGK-Cre. DNA was prepared after 48 hours and PCR amplification was carried out using primers at the 5 end of luciferase (P1) and within the EF-BOS promoter (P2). The DNA sequence shown in B. shows DNA fusion after the FLP-mediated deletion of between the frt sites. LH and RH = left and right hand
Supplementary figure 5 Analysis of mrna levels in chimaera-derived tumour cells A. QPCR Ct values for Mll and Mll-Enl transcripts Primer Set Average Ct Conditions of QPCR cdna source MEK 1 Mll-Mll 24.19 Full QPCR reaction Mll-Enl 24.44 Full QPCR reaction Actin 16.91 Full QPCR reaction MEK 5 Mll-Mll 23.98 Full QPCR reaction Mll-Enl 23.62 Full QPCR reaction Actin 15.28 Full QPCR reaction MEK 1 Mll-Mll 32.90 no reverse transcriptase Mll-Enl 34.31 no reverse transcriptase Actin 36.22 no reverse transcriptase MEK 5 Mll-Mll 32.91 no reverse transcriptase Mll-Enl 33.97 no reverse transcriptase Actin 37.76 no reverse transcriptase // Mll-Mll 33.64 No cdna template Mll-Enl 34.20 No cdna template Actin 37.03 No cdna template Table legend RT-PCR was carried out on cdna prepared from MEK1 and MEK5 cells (see Fig. 3 legend) and three sets of QPCR primers were used to assess Ct values for Mll, Mll-Enl and actin mrna. Control reactions were conducted with no reverse transcriptase enzyme and no cdna template as indicated. B. Sequence of Mll-Enl fusion cdna RT-PCR products were cloned and sequenced determined to verify the QPCR data. 1. Mll TGTGCTTTCTCTGTGCCAGCAGTGGGCATGTAGAGTTTGTGTATTGCCAAGTGTGTTGTGAACCCTTCC 2. Mll-Enl TGTGCTTTCTCTGTGCCAGCAGTGGGCATGTAGAGTGCACTGTCCAGGTGAAGTTAGAGCTGGGGCACC The black sequences Mll and blue Enl. Methods RNA was prepared from MEK 1 and MEK 5 spleen cells using the mirvana PARIS kit (Ambion) following the manufacturer s protocol. The RNA was DNaseI digested using a Turbo DNA-Free kit (Ambion) and reverse transcribed into cdna using SuperScript III First-Strand Synthesis System (Invitrogen) and the oligodt primers. QPCR primers were designed across the wild-type and fusion cdnas to produce amplicons of approx. 180bp. All four primers were chosen to have identical length and base-pair composition. The primers were the checked for homology to other regions of the Mouse genome using the UCSC Genome browser. Reference gene primers were designed in the same manner on β-actin cdna. All primers were tested for amplification efficiencies by using a fixed concentration of primer pair combinations (1uM each final concentration) across serial 5-fold dilutions of cdna, each in triplicate. The QPCR reactions were performed using Fast SYBR Green Master Mix (Applied Biosystems) and run on the Quick Start program for comparative expression (ddct) on the ABI 7500 Fast Real-Time PCR System cycler. Primer efficiencies were determined to be between 82 and 110%. Quantitative PCR was performed using a 1/10 dilution of cdna (and RT control cdna reaction), each reaction in triplicate. dct values were calculated by subtracting the average Ct value of the RT samples from the cdna samples. The ddct values were generated by subtracting the dct of the β-actin reference samples from the dct of the test reactions. Relative expression of the wild-type cdnas versus the fusion cdnas was calculated by converting the ddct into inverse log 2 values (2^-ddCT). The wildtype cdnas were assigned nominal values of 100% expression, and the reciprocal fusions % expression were determined relative to 100%. The identity of the Mll-Enl fusion RT-PCR product was verified by performing PCR on the MEK 5 cdna, using the cycling conditions as used for the QPCR (initial denaturation at 95 0 C x 20sec, then 40 cycles of 95 0 C x 3sec, 60 0 C x 30sec, with a final extension
at 72 0 C x 5minutes). PCR products were cloned into pgem T-Easy vector (Promega) and sequenced using using the T7 promoter forward primer.