Nucleic acid chemistry and basic molecular theory Nucleic acids DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Central Dogma of Molecular Biology Cell cycle DNA RNA Protein Transcription Translation How DNA works DNA sequences eventually form protein 1. Unique sequence of DNA (gene) 2. Specific sequence of RNA (messenger) 3. Specific amino acid sequence (part of protein) 4. Specific protein for specific biochemical function 1
What happens in a genetic abnormality: 1. Inappropriate sequence of DNA (mutation) 2. Inappropriate sequence of RNA 3. Inappropriate amino acid sequence 4. Abnormal protein, loss of specific, excess protein and therefore disease, abnormal appearance, retardation, etc. etc. The Genome What is it: one complete copy of an organism s DNA Human genome is comprised of between 20,000 to 35,000 genes packaged in a total of 46 chromosomes Haploid chromosome (as in a sperm or ovum) contains ~3 X 10 9 base pairs ~5% of chromosome sequence actually codes for protein Human chromosomes consist of one (or sometime 2 identical copies) of a long linear DNA molecule Prokaryotic cells (bacteria) have circular DNA Nucleotides Nucleotides have 3 parts: 1. Sugar 2. Nitrogenous base 3. Phosphate In DNA, the sugar is deoxyribose In RNA, the sugar is ribose Mmmm sugar 2
Bases In DNA, there are 4 bases (just like in baseball) A-adenine C-cytosine G-guanine T-thymine In RNA, uracil (U) replaces thymine Bases are either purines or pyrimidines, which are heterocyclic rings of carbon and nitrogen Bases Pyrimidines (C,T, and U) have one 6- member ring Purines (A and G) have a fused 6:5 member ring A pyrimidine binds to a purine in the double helix (Watson-Crick base pairs) A-T C-G A-U (RNA) How would you calculate the %G in a DNA molecule if you only know the %T? The bases are bound to the sugar molecule (either deoxyribose or ribose), making a nucleoside Add a phosphate group (PO 4 ) and you get a nucleotide DNA and RNA are polymers of nucleotides Nucleic acids can also be called oligonucleotides or polynucleotides 3
Sugar Phosphate Backbone The linear backbone of DNA or RNA is made of alternating sugar residues and phosphate groups 3-5 phosphodiester bond: A phosphate group links the 3 carbon atom of a sugar to the 5 carbon atom of the next sugar DNA ends Since phosphodiester bonds link carbon atom 3 of one sugar and carbon atom 5 of the next sugar, then at the end of each DNA strand there is a 5 carbon with only the phosphate attached hanging out at the end {5 end} The other end has the 3 carbon with only a free hydroxyl group {3 end} 4
5 to 3 It is conventional to write DNA sequences from 5 to 3 Complementary DNA strands are antiparallel, meaning the direction of one strand (5-3 ) is opposite of the other strand How do you write the complementary sequence of the following strand? 5 ATGGCCAAT 3 Double Helix The DNA strand has the sugar-phosphate backbone, with bases sticking out to the side DNA is generally double-stranded, so the strands are only held together by the bonds between the bases Remember hydrogen bonds, which connect two electronegative atoms (such as oxygen and nitrogen) with a hydrogen A-T has 2 hydrogen bonds G-C has 3 hydrogen bonds Base Pair: two nucleotides whose bases are joined by hydrogen bonds; this is a standard unit of measurement of DNA 1000 bp = 1kilobase or kb 5
Double helix has different conformations Right-hand helix A-DNA: 11 bases/turn B-DNA (most common): 10 bases/turn Left-hand helix Z-DNA: 12 bases/turn A-DNA B-DNA Z-DNA Bases are exposed in two grooves between the sugar-phosphate backbone, major and minor DNA does not have to be separated for a protein to bind a particular sequence Major Grooves Minor Grooves 6
Secondary Structure DNA and RNA can form a number of secondary structures by forming intramolecular bonds Inverted repeat sequences form hairpins/stemloop structures AGACCACCAGTACAAGACGTTTCTTGTACTGGAACAAG Try folding DNA at: http://mfold.bioinfo.rpi.edu/cgi-bin/dna-form1.cgi Holding DNA together Two strands of DNA are held together by hydrogen bonds (G-C, A-T) Base-stacking is another force that keeps DNA together Van der Waals interactions between adjacent bases stabilize the DNA and minimize energy The flat bases align like stacks of coins 7