SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells

Similar documents
Supplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2

Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or

Confocal immunofluorescence microscopy

GFP CCD2 GFP IP:GFP

SureSilencing sirna Array Technology Overview

SUPPLEMENTARY INFORMATION

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Online Supplementary Information

SUPPLEMENTARY INFORMATION

Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.

SANTA CRUZ BIOTECHNOLOGY, INC.

Supporting Information

Purification of Lactate Dehydrogenase

ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG

Supplementary Figure 1 Characterization of sirna-onv stability. (a) Fluorescence recovery curves of SQ-siRNA-ONV and SQ-ds-siRNA in 1 TAMg buffer

Isolation, culture, and transfection of primary mammary epithelial organoids

A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical

Coleman et al., Supplementary Figure 1

The Viability of Cancerous vs. Non-cancerous Cells

TE5 KYSE510 TE7 KYSE70 KYSE140

Hossain_Supplemental Figure 1

Supplementary Figure 1. Characterization of EVs (a) Phase-contrast electron microscopy was used to visualize resuspended EV pellets.

Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

SUPPLEMENTARY INFORMATION

Supplementary Materials for. Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer

Supplemental Data Supplementary Figure Legends and Scheme Figure S1.

affects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Information

FRAUNHOFER IME SCREENINGPORT

Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde

ab GFP ELISA Kit Instructions for Use For the quantitative measurement of GFP protein expression

One-Step Western TM Kit using TMB

Supplementary Information

HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT

- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.

Supplemental Information. Mitophagy Controls the Activities. of Tumor Suppressor p53. to Regulate Hepatic Cancer Stem Cells

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

TAG-LITE RECEPTOR LIGAND BINDING ASSAY

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Optimization of a LanthaScreen Kinase assay for BRAF V599E

Small-Molecule Drug Target Identification/Deconvolution Technologies

Tag-lite Tachykinin NK1 labeled Cells, ready-to-use (transformed & labeled), 200 tests* (Part# C1TT1NK1)

Different Potential of Extracellular Vesicles to Support Thrombin Generation: Contributions of Phosphatidylserine, Tissue Factor, and Cellular Origin

Notes to accompany the slidecast on theory of SDS PAGE and Western blotting

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplementary Information

IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity

SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency

* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)

42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)

Journal of Cell Science Supplementary Material

Award Number: W81XWH TITLE: Direct inhibition of Skp2 for the Treatment of Advanced Prostate Cancer. PRINCIPAL INVESTIGATOR: Hyun-Suk Lim

Khaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression

Sciences, Budapest, H-1117 Magyar tudósok körútja 2, PO Box 286, HUNGARY

Nanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression

BLOCK-iT Transfection Optimization Kit

Xfect Protein Transfection Reagent

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

Dolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system

Supplemental Materials and Methods

The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and

PD-1 Pathway Recombinant Protein Collection

Application Note AN001

TransIT-TKO Transfection Reagent

HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT

Reagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo

Kinase Reaction and Alkylation Protocol

Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with

Size Exclusion BioHPLC Columns

Supplementary Materials for

INSECT CELL/BACULOVIRUS PRODUCTION

Supporting Information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

A General Protocol for GST Pull-down Lili Jing *

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat

Gene Sequence Fragment size ΔEGFR F 5' GGGCTCTGGAGGAAAAGAAAG GT 3' 116 bp R 5' CTTCTTACACTTGCGGACGC 3'

Rat IGF-1 ELISA Kit (rigf-1-elisa)

Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation

Flow Cytometry - The Essentials

hfab Rhodamine Housekeeping Antibodies

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

Supplementary Figure 1

Supplementary Figure Legend

Supplementary Materials

ab GAPDH SimpleStep ELISA Kit

(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.

Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.

Fluo-8 Medium Removal Calcium Assay Kit

Chemically defined conditions for human ipsc derivation and culture

Applications involving the ViroCyt Virus Counter in the production of various recombinant proteins

ab Hypoxic Response Human Flow Cytometry Kit

Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics

Transcription:

SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal Halfmann 1, Jacinth Naidoo 1, Lai Wang 4, Lin Li 4, She Chen 3, Patrick Harran 5, Xiaoguang Lei 2,3*, and Xiaodong Wang 1,3* 1 Department of Biochemistry, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA. 2 School of Pharmaceutical Science and Technology, Tianjin University, Tianjin 300072, China 3 National Institute of Biological Sciences (NIBS), Beijing 102206, China 4 Joyant Pharmaceuticals, Dallas, TX 75207, USA 5 Department of Chemistry and Biochemistry, University of California, Los Angeles, CA 90095, USA (*) Corresponding author: wangxiaodong@nibs.ac.cn, leixiaoguang@nibs.ac.cn, and gelin.wang@utsouthwestern.edu, Tel: 0118610-80726688, Fax: 0118610-80726673 1

SUPPLEMENTARY RESULTS Supplementary Figure 1. Schematic of the screen design and procedure. 2

Supplementary Figure 2. Bioymifi efficiently kills a variety of cancer cells as singleagent. The dose-response curves for bioymifi or TR in the absence or presence of SM were plotted for HeLa, H460, U2OS, HT29, H1155, and Miapaca cell lines. Supplementary Figure 3. Full-length gel images of western blot depicted in the Figure 2 of main text. Supplementary Figure 4. DR5 sirnas specifically decrease the mrna levels of DR5 but not DR4. The DR5 and DR4 mrna levels in the knockdown cells were analyzed using quantitative RT-PCR. 3

Supplementary Figure 5. Sensitivity to bioymifi is similar in HCC15 parental cells and the DR5-overexpressing cells (15-13). The cells were treated with the indicated concentrations of bioymifi in the presence of SM for 48 hours. Supplementary Figure 6. Full-length gel images of western blot depicted in the Figure 3 of main text. 4

Supplementary Figure 7. (a) Both FADD and TRADD are required for TRAIL-induced apoptosis in MEFs. MEFs derived from WT, FADD -/-, or TRADD -/- mice were treated with 100ng/ml mouse TRAIL for 48 hours. The cell viability was measured by using the Cell Titer-Glo kit. (b-c) T98G cells were transfected with Luciferase and RIPK1 sirnas. After 48 hours, cell viability was measured, and the cell lysates were subjected to the western blot with RIPK1 and tubulin antibodies. Supplementary Figure 8. TRAIL mrna levels in the knockdown cells. T98G were transfected with three independent sirnas (TR-1, -2 or -3) for TRAIL. After 48 hours of transfection, RT-PCR was performed to assess the knockdown efficiency. 5

Supplementary Figure 9. A Coomassie-stained SDS-polyacrylamide (PAGE) gel showing purified recombinant proteins for His-tagged extracellular domain of DR4 (DR4-ECD) and DR5 (DR5-ECD). Supplementary Figure 10. A dilution series for bioymifi was produced from a 10mM DMSO stock into TBS buffer. After 1 hour incubation at room temperature, the solutions were centrifuged at 12,000rpm for 5 min. The absorbance for the supernatant of these samples was measured at 420 nm, which is the peak absorbance wavelength in TBS solution. 6

Supplementary Figure 11. Full-length gel images of western blot depicted in the Figure 5 and Figure 6 of main text. Supplementary Figure 12. Bioymifi stimulates high molecular weight complex formation. DR5-expressing cells were stimulated or not for 2 hours with 10 µμ bioymifi 7

in the absence or presence of SM. The cell lysates were fractionated on a Superdex-200 gel filtration column. Flag-DR5, FADD, and Caspase-8 were analyzed by western blotting. The size of the complex can be estimated by the molecular weight of the standard markers for size exclusion column indicated at the top of the figure. Supplementary Figure 13. Depletion of DR5 reduces the receptor clustering induced by bioymifi. (a) The DR5-expressing cells transfected with control or DR5 sirnas were treated with 10 µm bioymifi for 1 hour and then immunostained with a Flag antibody (red). The images were acquired using a DeltaVision microscope. The exposure time was 0.5 sec, and the images were processed using Image J software. Scale bar: 20 µm. (b) Cell lysates of Luciferase RNAi and DR5 RNAi cells were analyzed by western blot with Flag and actin antibodies. 8

Supplementary Figure 14. Bioymifi-induces aggregation is specific for DR5. (a) DR5-Flag-expressing cells were incubated for 1 hour with DMSO (control) or 5 µm bioymifi. The cells were immunostained with Flag, DR4, FAS, or TNFR1 antibodies. The images were taken using a Zeiss LSM 510 confocal microscope. Scale bar represents 10 µm. The percentage of the cells with clustering death receptor were quantified in (b) (n= 100). 9

Supplementary Table 1. SAR analysis identified an active compound, bioymifi, with a well-defined structure. Twenty-four chemical analogs of A2C2 were compared based on cell-killing efficacy. The dose-response curve was generated for each compound based on cell survival as measured using the Cell Titer-Glo Luminescent Cell Viability Assay. IC 50 values represent the concentration of compound that was required for 50% inhibition of cell viability. IC 50 values of cell viability were determined in T98G cells. 10

Supplementary Table 2. Kd (binding constant) and IC 50 values of the compounds used in the Figure 5c of main text. 11