DNA is contained in the nucleus of every cell in your body Cell Nucleus 1
DNA has a spiral staircase-like structure. The steps are formed by the nitrogen bases of the nucleotides where adenine pairs with thymine and cytosine with guanine.
DNA is made up of Nucleotides Each nucleotide consists of a Phosphate Sugar Base A,T,G or C
DNA is contained in chromosomes which contain matching genes called alleles bsapp.com
Chromosomes are located in the nucleus of every cell Humans have 23 pairs of chromosomes If uncoiled, the DNA in one cell would stretch 6 feet One strand of DNA contains more than 200,000,000 base pairs There are approximately 20,000 diferent genes If the DNA in your body was streatched end ot end, it would go around the earth about 90,000 times. 5
23 chromosome pairs 46 chromosomes 44 autosomes, 2 sex chromosomes X and Y chromosomes XX female XY Male
Human Genome Project in the 1990s mapped every gene in human DNA They found that a lot of bases in our DNA don t seem to code for anything They are called non-coding DNA, or Junk DNA 7
There seem to be regions on all of our DNA that just don t code for anything 8
Non-coding, or Junk DNA, seems to increase as species get more complex Human DNA seems to be about 90% Junk 9
Discovery of Satellite DNA When scientists were trying to find out more about DNA, they used a centrifuge to separate out the DNA. They noticed satellite bands above the main DNA layer. Uniform Gradient DNA fragments Centrifugation Satellite bands of DNA Main band of DNA Cell debris 10
DNA from the satellite bands was named satellite DNA. Satellite DNA consists of highly repetitive sequences found mostly in centromeres and telomeres. 11
The length of repeat unit varies in satellite DNA. DNA with repeat unit from 2 to 6 bases long is called microsatellite DNA because the repeat sequence is shorter. The term microsatellite DNA is based on the historical term of satellite DNA. The location of microsatellite is mostly NOT found on centromeres or telomeres of the chromosomes. 12
Terms in genetics: example in human chromosomes Locus is the specific position on the chromosome. Homologous chromosomes (one from father and one from mother) Locus (heterozygous: having two different alleles) Allele is alternative form of a gene at a locus. Homozygous: having the same allele at a locus. Heterozygous: having different alleles at a locus. 13
Tandem Repeats Portions of the DNA molecule contain sequences of bases that are repeated numerous times, known as tandem repeats What is important to understand is that all humans have the same type of repeats, but there is tremendous variation in the number of repeats each of us have. 14
Those with two-base repeat unit Types of Microsatellites CGACTAGCCACGTGTGTGTGTGTGTGTGTGTGTACAGGACTTAGC 11 repeats (allele 11) Those with three-base repeat unit TTCTAGCCGCTTGTTGTTGTTGTTGTTGTTGTTGCCAGTACTCAG Those with four-base repeat unit 8 repeats (allele 8) GCGAAGTTCCGAATGAATGAATGAATGAATGAATGAATGCCGCATT 7 repeats (allele 7) Most microsatellite DNA loci used in human identification have 4-base pair repeats. Microsatellites are also called Short Tandem Repeats (STRs). 15
Slippage during DNA replication creates variation in number of repeat units Normal replication GAC GAC GAC GAC GAC GAC CTG CTG CTG CTG CTG CTG New strand Template strand Slippage in new strand A G C GAC GAC GAC GAC GAC GAC CTG CTG CTG CTG CTG CTG Next replication GAC Insertion mutation (n+1) GAC GAC GAC GAC GAC GAC CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG GAC GAC GAC GAC GAC GAC Normal length Slippage in template GAC GAC GAC GAC GAC CTG CTG CTG CTG CTG C G T Next replication Deletion mutation (n-1) CTG CTG CTG CTG CTG GAC GAC GAC GAC GAC CTG CTG CTG CTG CTG CTG GAC GAC GAC GAC GAC GAC Normal length 16
Q: A person has the following microsatellite sequence on one chromosome: Repeat region GCGAAGTTCCGGATGGATGGATGGATGGATGGATGCCGCATT What is the sequence of the repeat unit? A. ATG B. GATG C. ATGGAT D. GGATGG E. None of the above 17
The genotype of a person for each locus is shown as the number of repeat units he/she carries. Since a person is diploid and has a pair of homologous chromosomes, the genotype is shown as two numbers. Genotype 6, 8 (6 repeats, 8 repeats) Repeat sequences Repeat sequences Genotype 7, 7 (7 repeats, 7 repeats) 18
Q: If this person s homologous chromosomes have the following sequences: Repeat region GCGAAGTTCCGGATGGATGGATGGATGGATGCCGCATT CGCTTCAAGGCCTACCTACCTACCTACCTACGGCGTAA GCGAAGTTCCGGATGGATGGATGGATGGATGGATGGATGCCGCATT CGCTTCAAGGCCTACCTACCTACCTACCTACCTACCTACGGCGTAA What is the sequence of the repeat unit? A. GAT B. GATG C. GATGG D. CTA What is this person s genotype? A. TH01: 4,6 B. TH01: 5, 6 C. TH01: 6, 7 D. TH01: 5, 7 Using Base Pairs of A-T and C-G, what is the complement of TGGAT? A. GGTAT B. TTAGT C. CAACA D. ACCTA 19
3 Types of DNA Testing RFLP - Restriction Fragment Length Polymorphism STR Short Tandem Repeats MtDNA Mitochondrial DNA bsapp.com
RFLP (Restriction Fragment Length Polymorphism) Oldest/Cheapest test Requires large amounts of nondegraded DNA Utilizes the longer sequences of VNTR s bsapp.com
What to do when there s not much there
PCR (Polymorphism Chain Reaction) Does NOT give identity Increases the amount of DNA available for typing by producing millions of copies Use to amplify tiny quantities and degraded samples Extremely sensitive to contamination bsapp.com
Heat separates DNA Primer attaches Duplicate strand formed
PCR and RFLP PCR technology cannot be applied to RFLP DNA typing. The RFLP strands are too long, often numbering in the thousands of bases. PCR is best used with DNA strands that are no longer than a couple of hundred bases. 33
Short Tandem Repeats (STRs) STRs consist of repeating sequences of 3 to 7 bases in length, and the entire strand of an STR is also very short, less than 450 bases in length. They serve as useful markers for identification because they are found in great abundance throughout the human genome. Used to evaluate specific regions (loci) of DNA strands Utilizes shorter stands than VNTR s Usually requires PCR prior to testing 34
STR Number of repeats is transferred just like any other DNA material Works on very tiny sample sizes when amplified by PCR thousands of STR sites have been identified
Mitochondrial DNA Analysis Used for samples that cannot be analyzed using RFLP or STR Uses DNA extracted from mitochondrion rather than nuclear DNA Mitochondrial DNA degrades at a much slower rate than nuclear DNA Allows analysis of older biological samples, such as hair and bones Not as precise as STR Extremely expensive and time consuming
bsapp.com
Mitochondria are the powerhouses Oocyte of the Maturation cell. Cellular energy comes from mitochondira. Mitochondria have their own DNA.
Regular DNA - from all of your ancestors. Mitochondrial DNA is inherited from your mother ONLY