Revised: RG-RV2 by Fukuhara et al.

Similar documents
TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

Supplementary Methods

Table S1. Oligonucleotide primer sequences

Supplemental Figure 1

SUPPLEMENTARY INFORMATION

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Pei et al. Supplementary Figure S1

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation

Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.

Table S1. Primers used in the study

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.

Supplementary Figure 1 Generation of migg1-yf mice. (A) Targeting strategy. Upper panel: schematic organization of the murine ɣ1 immunoglobulin

DRG Pituitary Cerebral Cortex

Supplementary Materials for

SUPPLEMENTAL MATERIAL

Supplementary Information

Nature Immunology: doi: /ni.3694

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

(a) Scheme depicting the strategy used to generate the ko and conditional alleles. (b) RT-PCR for

Supplementary Information

Nature Medicine doi: /nm.2548

Ramp1 EPD0843_4_B11. EUCOMM/KOMP-CSD Knockout-First Genotyping

Usp14 EPD0582_2_G09. EUCOMM/KOMP-CSD Knockout-First Genotyping

SUPPLEMENTARY INFORMATION

Supplemental Figure 1

Supplementary Fig. 1 Generation and genotyping of ThPOK / mice

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)

SUPPLEMENTARY INFORMATION

Multiple layers of B cell memory with different effector functions. Ismail Dogan, Barbara Bertocci, Valérie Vilmont, Frédéric Delbos,

Supplemental Material TARGETING THE HUMAN MUC1-C ONCOPROTEIN WITH AN ANTIBODY-DRUG CONJUGATE. Supplemental Tables S1 S3. and

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

The RRPA knock-in allele was generated by homologous recombination in TC1 ES cells.

Supplemental Information. Role of phosphatase of regenerating liver 1 (PRL1) in spermatogenesis

Percent survival. Supplementary fig. S3 A.

SUPPLEMENTAL MATERIAL

Supplementary Figures and Figure legends

Nature Biotechnology doi: /nbt Supplementary Figure 1. Substrate-linked protein evolution components.

Dominguez et al., 2005

Easi CRISPR for conditional and insertional alleles

MLN8237 induces proliferation arrest, expression of differentiation markers and

7.012 Problem Set 5. Question 1

We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and

A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase

Supplementary Information. Isl2b regulates anterior second heart field development in zebrafish

Supplementary Figure 1

Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified

SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplemental Table S1. RT-PCR primers used in this study

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplemental Data. Na Xu et al. (2016). Plant Cell /tpc

monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in

Figure S1. Phenotypic characterization of transfected ECFC. (a) ECFC were transfected using a lentivirus with a vector encoding for either human EPO

indicated numbers of pups at day of life (DOL) 10, or embryonic day (ED) B. Male mice of

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.

T H E J O U R N A L O F C E L L B I O L O G Y

i-stop codon positions in the mcherry gene

Construction of plant complementation vector and generation of transgenic plants

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Data. Plasmid -2486CAT containing the 2.5 kb fragment of VE-cadherin promoter region (-2486

TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:

SUPPLEMENTAL METHODS. Chromatin immunoprecipitation (ChIP) assay. Cell culture. Non-ablated mouse transplantation. Hematology and flow cytometry

SUPPLEMENTARY INFORMATION

Supplemental Information. T Follicular Helper Cell-Germinal Center B Cell. Interaction Strength Regulates Entry into Plasma

the tamoxifen treatment schedule used to induce recombination. Arrows indicate on which

Supplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Map-Based Cloning of Qualitative Plant Genes

A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish

Persistent fibroblast growth factor 23 signalling in the parathyroid glands for secondary. hyperparathyroidism in mice with chronic kidney disease

Supplementary Materials

A Nucleus-Encoded Chloroplast Protein YL1 Is Involved in Chloroplast. Development and Efficient Biogenesis of Chloroplast ATP Synthase in Rice

Myofibroblasts in kidney fibrosis. LeBleu et al.

Supplemental Materials. Matrix Proteases Contribute to Progression of Pelvic Organ Prolapse in Mice and Humans

SUPPLEMENTARY INFORMATION

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Supplementary Materials

Supplemental Data. Farmer et al. (2010) Plant Cell /tpc

8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Rassf1a -/- Sav1 +/- mice. Supplementary Figures:

Supplementary Figure 1

Before starting, write your name on the top of each page Make sure you have all pages

Experimental genetics - 2 Partha Roy

Loss of Cul3 in Primary Fibroblasts

Supplementary Figure 1: Expression of RNF8, HERC2 and NEURL4 in the cerebellum and knockdown of RNF8 by RNAi (a) Lysates of the cerebellum from rat

Nature Biotechnology: doi: /nbt.4166

Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox

Nature Biotechnology: doi: /nbt Supplementary Figure 1. In vitro validation of OTC sgrnas and donor template.


To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR

Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate

Supplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line

SUPPLEMENTAL MATERIALS

Transcription:

Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the deleted allele (Spns2 - ). In the targeted allele, exon 2 of the Spns2 gene (yellow box) is flanked by two loxp sites (green arrowheads). Together with the first loxp site, a neomycin selection cassette, PKG-Neo-pA (gray box), flanked by two frt sites (orange 1

arrowheads) has been inserted. Mice carrying the targeted Spns2 allele were crossed with transgenic mice expressing Flp recombinase under the control of cytomegalovirus early enhancer/chicken beta actin (CAG) promoter to remove the PKG-Neo-pA cassette, resulting in the Spns2 floxed mice. To generate conventional Spns2 knockout mice, the mice carrying a floxed Spns2 allele were crossed with transgenic mice expressing the Cre recombinase under the control of cytomegalovirus (CMV) promoter. To inactivate the Spns2 gene in endothelial cells, the Spns2 floxed mice were bred with Tie2-Cre mice that carry the Cre recombinase driven by the Tie2 promoter. (B) Southern blot analysis of AvrII-digested genomic DNA from tail biopsies of Spns2 f/f, Spns2 -/- and Spns2 +/+ mice were carried out using a probe indicated in A (blue line). As expected, 7.2 kb, 7.5 kb and 7.0 kb bands were detected in wild type (Spns2 +/+ ), Spns2 floxed (Spns2 f/f ) and Spns2 knockout (Spns2 -/- ) mice. (C) PCR analysis of the genomic DNA from Spns2 f/f, Spns2 -/- and Spns2 +/+ mice were performed using a primer set to amplify the exon 2 as indicated in A (red arrows). 552-bp, 842-bp and 316-bp fragments were amplified in wild type (Spns2 +/+ ), Spns2 floxed (Spns2 f/f ) and Spns2 knockout (Spns2 -/- ) mice. (D) Genomic PCR analysis of Spns2 +/+, Spns2 -/-, Spns2 f/-, Spns2 f/- ;Tie2Cre, Spns2 f/f, Spns2 f/f ;Tie2Cre mice were performed using the primer sets to amplify the exon 2 of Spns2 gene (upper panel) and Cre recombinase gene (lower panel). 2

Supplemental Figure 2 Spns2 KO mice are functionally disrupted for Spns2. (A) Schematic representation of the exon/intron structure of the wild type Spns2 allele and the corresponding wild type mrna (Wt mrna). A mutant mrna transcribed from the Spns2 deleted allele lacking exon 2 (Mutant mrna) is also shown at the bottom. Boxes and polylines represent exons and introns, respectively. Blue and gray boxes correspond to the coding and non-coding exons, respectively. Red boxes indicate exon 2. The size of exon is given below each exon. The mrna derived from the Spns2 deleted allele results in an in-frame deletion of exon 2. (B) RT-PCR analyses of RNAs extracted from the lungs of wild type (Spns2 +/+ ) and Spns2 KO (Spns2 -/- ) mice were performed using two sets of PCR primers as indicated in A (blue and green arrows). The size difference between the two bands is consistent with the absence of exon 2 (66 bp) in the mutant mrna. Sequencing of the PCR products showed that Spns2 KO mice express a mutant mrna transcript lacking exon 2-derived sequence encoding aa 124-145 of wild type Spns2. (C) HUVECs were transfected with the plasmid expressing either wild type (Wt) or mutant (Mutant) Spns2 carboxy-terminally tagged GFP or with myristoylated 3

GFP-encoding plasmid (Myr-GFP). GFP and phase contrast images were obtained using an IX81 inverted microscope (Olympus). Note that mutant Spns2 protein failed to localize at the plasma membrane. (D) HEK293 cells were transfected with the plasmid expressing human Spns2 (hwt), mouse Spns2 (mwt) or mouse Spns2 mutant (mutant) together with or without the Sphk1-expressing vector as indicated at the bottom. S1P release from those cells was examined as described in Methods. Data are shown as means ± S.D. (n=4). Note that Spns2 mutant lost the ability to export S1P. 4

Supplemental Figure 3 Spns2 KO mice develop normally except for the symblepharon formation. (A-F) Body and organ weights of 10-week-old wild type (Spns2 +/+ ) and Spns2 KO (Spns2 -/- ) mice were measured (body weight (A), heart (B), lung (C), liver (D), spleen (E), kidney (F)). There were no differences in body and organ weights between wild type and Spns2 KO mice. Data are shown as means ± S.D. (wild type, n=11; Spns2 KO, n=10). (G) Spns2 KO mice exhibit symblepharon. 5

Supplemental Figure 4 The biochemical examination of the blood of Spns2 KO mice. Plasma levels of total protein (TP) (A), total bilirubin (TBIL) (B), aspartate aminotransferase (AST) (C), alanine aminotransferase (ALT) (D), triglycerol (TG) (E), glucose (GLU) (F), blood urea nitrogen (BUN) (G) and albumin (ALB) (H) in 8-week-old wild type (Spns2 +/+ ) and Spns2 KO (Spns2 -/- ) mice. There were no differences in blood biochemical parameters between wild type and Spns2 KO mice. Data are shown as means ± S.D. (n=4). 6

Supplemental Figure 5 The hematological profile of Spns2 KO mice. Blood was collected from 8-week-old wild type (Spns2 +/+ ) and Spns2 KO (Spns2 -/- ) mice, and analyzed for white blood cells (WBC) (A), red blood cells (RBC) (B), platelets (C), hemoglobin (HBG) (D), hematocrit (HCT) (E), mean corpuscular volume (MCV) (F), mean corpuscular hemoglobin (MCH) (G) and mean corpuscular hemoglobin concentration (MCHC) (H). Spns2 KO mice exhibited a decreased count of white blood cells compared with wild type mice. Data are shown as means ± S.D. (n=4). 7

Supplemental Figure 6 A representative flow cytometric analysis of peripheral blood cells from control (Spns2 +/+ ) and global Spns2 KO (Spns2 -/- ) mice. (A) The numbers represent the percentage of CD4 and CD8 single-positive (SP) T cells in total lymphocytes. (B) The numbers represent percentages of IgD + CD23 + cells in CD19 + peripheral blood lymphocytes (mature recirculating B cells; Mature rec. B) in the gate on the plots. 8

Supplemental Figure 7 Histological analyses of the thymi and peripheral lymph nodes (LN) of Spns2 KO mice. Representative hematoxylin and eosin stained sections of thymus and peripheral LN from wild type (Spns2 +/+ ) and Spns2 KO (Spns2 -/- ) mice. No striking structural differences of thymus and peripheral LNl between Spns2 KO and control mice were detected. 9

Supplemental Figure 8 Increased proportion of fully mature SP T cells and decreased proportion of semi-mature SP T cells in the thymi of Spns2 KO mice. (A) Frequencies (left) and numbers (right) of semi-mature (CD69 + CD62L lo/- ) and fully mature (CD69 lo/- CD62L + ) CD4 SP T cells in the thymi of control (Spns2 +/+ ) or Spns2 KO (Spns2 -/- ) mice (n=8). (B) Frequencies (left) and numbers (right) of semi-mature (CD69 + CD62L lo/- ) and fully mature (CD69 lo/- CD62L + ) CD8 SP T cells in thymi of control (Spns2 +/+ ) or Spns2 KO (Spns2 -/- ) mice (n=8). (C) Flow cytometric analysis for the expression of CD69 on fully mature CD62L + CD4 (left) and CD8 (right) SP T cells in the thymus of control (black line) or Spns2 KO (orange line) mice. Control antibody staining is shown shaded in grey. Data are representative for eight pairs of mice. 10

Supplemental Figure 9 Reduced numbers of mature recirculating B (Mature rec. B) cells in the bone marrow of Spns2 KO mice. Representative flow cytometric analysis of bone marrow derived B cells from control (Spns2 +/+ ) or Spns2 KO (Spns2 -/- ) mice. (A) The numbers indicate the percentage of IgM and IgD expressing CD19 + B cells. Mature recirculating B (Mature rec. B) cells and immature B cells were identified as CD19 + IgM + IgD + and CD19 + IgM + IgD -, respectively. (B) Frequencies (left) and numbers (right) of mature recirculating B cells and immature B cells are shown (n=11). Bars and circles indicate averages and values for individual mice, respectively. 11

Supplemental Figure 10 Amount of plasma S1P bound to HDL and albumin in control (Spns2 +/+ ) or Spns2 KO (Spns2 -/- ) mice. (A) Representative gel filtration profiles of plasma S1P (bars) and protein (solid line) from control (top: Spns2 +/+ ) and Spns2 KO (bottom: Spns2 -/- ) mice. 100 l of plasma was chromatographed on a Superose 12 column. Fractions were collected every 2 min (0.5 ml). For each fraction, S1P concentration was determined. Slashed and gray bars indicate the amount of S1P bound to HDL and albumin, respectively. (B) Amount of S1P associated with HDL and albumin in 100 l of plasma from control (Spns2 +/+ ) or Spns2 KO (Spns2 -/- ) mice (n=2). 12

Supplemental Figure 11 PCR analysis of the genomic DNA isolated from the bone marrow of wild type mouse (Spns2 +/+ ), Spns2 KO mouse (Spns2 -/- ) and 13 Spns2 KO mice reconstituted with wild type bone marrow (#1~#13) was performed as described in the legend of Supplementary Figure 1C. 552-bp and 316-bp PCR products represent the wild type and Spns2-deleted alleles, respectively. Note that the bone marrow of Spns2 KO mice was successfully reconstituted by that of wild type mice. 13

Supplemental Figure 12 In situ hybridization for Spns2 mrna. Antisense probe was hybridized to the sections of heart, lung, hypothalamus, olfactory bulb and kidney (Spns2: purple). Serial sections were also stained with anti-cd31 antibody (CD31: brown) to identify the endothelial cells. The scale bars represent 20 m. 14

Supplemental Figure 13 Plasma concentrations of S1P in control (Spns2 f/f ) or EC-Spns2 cko (Spns2 f/f ;Tie2Cre) mice. Data are shown as means ± S.D. (n=3). 15

Supplemental Figure 14 Reduced number of mature T cells in peripheral lymph nodes of EC-Spns2 cko mice. Frequencies (left) and numbers (right) of CD4 SP (CD4) and CD8 SP (CD8) T cells in peripheral lymph nodes from control (Spns2 f/f ) or EC-Spns2 cko (Spns2 f/f ;Tie2Cre) mice are shown (n=11). Bars and circles indicate averages and values for individual mice, respectively. 16

Supplemental Figure 15 Reconstitution of EC-Spns2 cko mice with control bone marrow. (A) PCR analysis of the genomic DNA isolated from the bone marrow of wild type mouse (Spns2 +/+ ), Spns2 KO mouse (Spns2 -/- ), Spns2 floxed mouse (Spns2 f/f ), 8 Spns2 floxed mice reconstituted with bone marrow from Spns2 floxed mice (Spns2 f/f Spns2 f/f ) and 9 EC-Spns2 cko 17

mice reconstituted with bone marrow from Spns2 floxed mice (Spns2 f/f Spns2 f/f,tie2cre) was performed as described in the legend of Supplementary Figure 1C. 552-bp, 842-bp and 316-bp PCR products represent the wild type, Spns2-floxed and Spns2-deleted alleles, respectively. Note that the bone marrow of EC-Spns2 cko was successfully reconstituted by that of Spns2 floxed mice. (B, C) Flow cytometric analyses of Spns2 floxed mice reconstituted with bone marrow from Spns2 floxed mice (Spns2 f/f Spns2 f/f ) and EC-Spns2 cko mice reconstituted with bone marrow from Spns2 floxed mice (Spns2 f/f Spns2 f/f,tie2cre). (B) Frequencies and total numbers of CD4 SP (CD4) (left) and CD8 SP (CD8) (right) T cells in the thymus are shown (Spns2 f/f Spns2 f/f, n=8; Spns2 f/f Spns2 f/f,tie2cre, n=9). (D) Frequencies and total numbers of CD4 SP (CD4) (left) and CD8 SP (CD8) (right) T cells in the peripheral blood are shown (Spns2 f/f Spns2 f/f, n=8; Spns2 f/f Spns2 f/f,tie2cre, n=9). 18

Supplemental Figure 16 Reduced number of mature recirculating B cells in bone marrow of EC-Spns2 cko mice. Flow cytometric analyses of bone marrow derived B cells from control (Spns2 f/f ) or EC-Spns2 cko (Spns2 f/f ;Tie2Cre) mice. (A) The numbers indicate the percentage of IgM and IgD expressing CD19 + B cells. Mature recirculating B (Mature rec. B) cells and immature B cells were identified as CD19 + IgM + IgD + and CD19 + IgM + IgD -, respectively. (B), Frequencies (left) and numbers (right) of mature recirculating B cells and immature B cells are shown in left and right panels, respectively (n=11). Bars and circles indicate averages and values for individual mice, respectively. 19

Supplemental Figure 17 Number of mature recirculating B cells in peripheral lymph nodes of EC-Spns2 cko mice. Frequencies (left) and numbers (right) of mature recirculating B cells (CD19 + CD23 + IgD + ) in peripheral lymph nodes from control (Spns2 f/f ) or EC-Spns2 cko (Spns2 f/f ;Tie2Cre) mice are shown (n=11). Bars and circles indicate averages and values for individual mice, respectively. 20

Supplemental Figure 18 Flow cytometric analyses of Spns2 floxed mice reconstituted with bone marrow from Spns2 floxed mice (Spns2 f/f Spns2 f/f ) and EC-Spns2 cko mice reconstituted with bone marrow from Spns2 floxed mice (Spns2 f/f Spns2 f/f,tie2cre). Frequencies (left) and total numbers (right) of mature recirculating B cells in the bone marrow (A) and peripheral blood (B) are shown (Spns2 f/f Spns2 f/f, n=8; Spns2 f/f Spns2 f/f,tie2cre, n=9). 21

2024 © businessdocbox.com Privacy Policy | Terms of Service | Feedback