Making sense of DNA For the genealogist

Making sense of DNA For the genealogist Barry Sieger November 7, 2017 Jewish Genealogy Society of Greater Orlando OUTLINE Basic DNA concepts Testing What do the tests tell us? Newer techniques NGS Presentation notes can be found on Program page jgsgo.org 4 Human Genome Autosomal DNA 22 chromosomes Sex chromosomes : XX female line XY - male line Y DNA exclusive male line Mitochondrial mtdna extra-nuclear, female line 7 1

11/1/17 8 Human Chromo-somes 22 autosomes are double stranded diploid One of the pair is derived from the mother and the other from the father. Each has the same genes at the same loci (± with alternative forms) - homologous. Sex cells - single stranded haploid 10 Human Chromosomes Each chromosome contains 100s to 1000s of genes TOTAL # for 23 chromosomes = ~21,000 genes & > 3 billion base pairs of DNA code. Genes carry instructions for making proteins Most of the human genome has been sequenced 11 2

DNA-gene code DNA DeoxyriboNucleic Acid A double helix (pic) Crick & Watson 1953 4 Nucleotides form backbone of DNA & gene code Nucleotides Nitrogen, sugar, phosphate group ACGT o Adenine o Cytosine o Guanine o Thymine 12 DNA DNA in a single human cell would measure ~6.5 The average human contains 10-20 billion miles of DNA amongst its total cells (37 TRILLION). Single human genes contain ~27,000 base pairs long, up to 2 million base pairs. 13 DNA CODE Digital ASCII Binary code 2 parts - #s - 0 s & 1 s Barry o B 01000010, o A 01000001, o R 01010010, o R 01010010, o Y 01011001 DNA code quaternerary 4 parts : ACGT >one gene tells cell to make a certain protein = ACATGAGACAGACAGACCCCCAGAGACAGACC CCTAGACACAGAGAGAGTATGCAGGACAGGGTTT TTGCCCAGGGTGGCAGTATG 14 3

DNA CODE 15 Genetic Analysis DNA STUDY Autosomal DNA Y-DNA mtdna X chromosome 11/1/17 17 Sequencing : the process of determining the precise order of the nucleotide code within a DNA molecule - ATGC Can be partial or complete SEQUENCING 18 4

DNA TESTING REQUIRES sequencing. Looks for genetic variations or mutations Related people share the same mutations. Common genetic mutations include: o SNPs single nucleotide polymorphisms o STRs short tandem repeats These are used extensively in testing of mtdna and Y-DNA. Longer, shared DNA segments indicate a closer genetic relationship 19 SNP single nucleotide polymorphism A polymorphism is a variation from a standard or normal An SNP is a single nucleotide variant of DNA in a string that can vary from one person to the next. Testing looks at variations along 100 s or 1000 s of locations People who are who are very closely related should have the same SNP (polymorphism) at every location. Non-related persons have different SNP s. Person 1 & person 2 have different SNP S & are NOT related 20 STR - short tandem repeat A number of repeats of a particular DNA sequence at a particular location in a tandem arrangement. Individuals who share these unique mutations considered to be related This is used in Y DNA testing along with Y-SNP testing Haplotypes & haplogroups are derived from STR testing. 21 5

HAPLOTYPES Definition - a specific group of genes that a progeny inherits from one parent (Wiki) HAPLOTYPES Gene clusters (alleles) are inherited together and likely to be conserved as a sequence that survives the descent of many generations of reproduction Defined by SNPs or STRs. Haplotypes refer to individuals. 22 HAPLOGROUPS A group of related individuals who have a recent common ancestor on a particular branch as defined by specific SNP or STR mutations CLADE Named with letters and numbers, individuals in the same haplogroup will have the same list of mutations. Maternal haplogroups mtdna defined Paternal haplogroups Y DNA defined In most cases, scientists have a good idea of the general location where mtdna haplogroup ancestors lived & migrated to. HAPLOGROUPS GO BACK 1000 S OF YEARS ancient origins. 23 HAPLOGROUPS 24 6

HAPLOGROUP PROJECTS Y DNA, MTDNA PROJECTS join researchers with groups from the same Haplogroup. DNA PROJECTS: Haplogroup, Surname, geographic Get advice for further testing, compare your results with others, share new information, help in assessing validity of matches, possibility of joining subgroups. https://www.familytreedna.com https://www.worldfamilies.net/projectfaq#what SURNAME PROJECTS https://isogg.org/wiki/ 25 HAPLOGROUPS 26 Phylogenetic tree Tree describes the branching of major haplogroups. which are based on Y DNA or mtdna haplogroups. CLADE Letters (A,B,C,D, ETC) (SEE BELOW) establish the branches which are 1000 s of years old DNA used this way shows that Jews have their own genetic signature. These trees are able to identify migratory paherns of the haplogroups. 27 7

Phylogenetic tree of Haplogroup J2 28 Y-DNA XY- male sex chromosomes, 1 of 23 pairs o Y from father X from mother Y gene : 50,000,000 base pairs 200 genes Y chromosome always passes down from father to son. Females do not receive it. As the Y chromosome is passed on through the parental line, it is valuable for surname based genealogy studies. A father with daughters only will not t/f his Y chromosome further. 29 Y DNA Testing Y Chromosome can accumulate one or more mutations or variations that can be detected by a test and useful for genealogical analysis. Y-DNA testing will help determine if 2 individuals are paternally related. Testing done via Y-STR or Y-SNP testing 30 8

Y DNA 31 Y-DNA Testing Y-STR tests estimate the paternal haplogroup, while Y-SNP tests definitively determine the paternal haplogroup. ANCIENT ORIGINS The results of a Y-STR sequencing test can be used to fish for genetic cousins. Since the Y chromosomes mutates relatively rapidly and at a well-characterized rate, Y-STR testing is very good at finding random genetic matches in a testing company s database and estimating how many generations have passed since two men shared a common paternal ancestor. Blaine Bettinger 32 Y DNA Testing LIMITATIONS Y DNA as currently tested NOT considered useful for identifying specific relatives. Only short segments analyzed in current testing. Next Generation Sequencing (NGS) addresses many of these deficiencies Should join a Y DNA Haplogroup project to help analyze results 33 9

mtdna a double-stranded, circular DNA that is stored in mitochondria outside the nucleus. mtdna is passed down by the mother unchanged, to all her children, both male and female. Traces the female line mtdna changes relatively slowly can go back 1000 s of yrs but still susceptible to mutations. A mitochondrial DNA test can be taken by both men and women. Haplogroups can be determined 34 mtdna TESTING LIMITATONS Testing is done by SNP analysis at multiple loci Difficult to pinpoint how closely related 2 individuals with mtdna matches are since Individuals with identical mtdna can be related either very recently or as much as several thousand years ago. One must review the matches within online family trees or contact the match 35 UPLOAD RESULTS Uploading results to different web sites allows other researchers who share similar DNA markers to connect with you. Family Tree DNA - https://www.familytreedna.com o Ysearch.org for people who have tested with different companies. My Heritage - https://www.myheritage.com Mitosearch.org - mtdna 36 10

autodna testing In order to understand what happens with autodna testing you have to understand o Recombination o Meiosis & o Endogamy 37 MEIOSIS A type of cell division Occurs during germ production - gametes results in four daughter cells each with half the number of chromosomes of the parent cell diploid cell becomes haploid During meiosis, the autosomal chromosomes recombine and mutations may occur. 39 RECOMBINATION Process during which genetic material is shuffled during reproduction to form new combinations This mixing is important from an evolutionary standpoint because it allows the expression of different traits (diversity) between generations leads to offspring having different combinations of genes from those of their parents 40 11

RECOMBINATION The process involves a physical exchange of nucleotides between duplicate strands of deoxyribonucleic acid (DNA ). facilitated by chromosomal CROSSOVER. RECOMBINATION reduces the lengths of DNA remaining intact in each new generation. In >= 6 generations, the length of DNA pieces becomes too small to be detected and matched between cousins, with the methodology now used by DNA companies. 41 Endogamy Endogamy is the practice of marrying within the same ethnic, cultural, social, religious or tribal group In endogamous populations everyone will descend from the same small gene pool Relatedness within ethnic group MORE LIKELY. Such people will typically have large numbers of matches in the DNA databases. The interpretation of autosomal DNA matches can be particularly difficult, especially in the case of endogamous populations where the pedigrees cannot be traced back beyond the 1800s. https://isogg.org/wiki/endogamy 43 The Challenge of too many DNA Matches In DNA testing a key question is How likely is it that I am related to someone with whom I match? Obviously if you share the same surnames, and geographic experiences, relatedness becomes more likely. Additionally if your DNA is quite similar to that of a match, that also increases the possibility of relatedness. A scientific method of comparison was needed to compare the DNA of one individual with another One approach involves using centimorgans it is a quantitative method of comparing one person s DNA to another. 44 12

centimorgan Measures the relatedness of one person to another The higher the number the more closely related UR Companies look at total amount of common DNA, number of common segments, and/or the length or size of the longest common segment to derive cm s Longer strands more cm s - closer & more recent relationship Shorter strands - fewer cm s - less relatedness & temporally more distant. With each passing generation, in atdna TESTING, one shares less DNA with a relative, due to RECOMBINATION..cM s reduce in value (atdna). 46 47 atdna testing - FF Analyzes our 22 autosomes for relatedness o Analyzes hundreds of thousands of SNP s. A child inherits 50% of atdna from his father & 50% from his mother Used to estimate ethnicity and find genetic cousins. Useful for recent ancestry after 6 generations, DNA is replaced and usefulness minimal. Due to endogamy an individual may have thousands of matches (marrying within same group), many of which are not significant. With atdna testing, any of your ancestors could have provided the matching DNA, unlike mtdna or Y DNA testing. 48 13

autodna testing TOOL FTDNA ($) & 23andMe provide a Chromosome Browser That allows you to compare your matching DNA segments (blocks) with your genetic matches to see how much DNA the user shares shared in common with them Allows you to see if the segments that match are in the same place on the same Chromosome. Upload results to Family Tree DNA and My Heritage & GedMATCH & other sites to compare with others 49 Next Generation Sequencing New techniques have allowed complete sequencing of genomes quickly Faster and cheaper - eliminates fragment coding Value o Offers more precise and detailed sequencing o Helps to find ancestor matches, o Expands phylogenetic tree elucidation ancient origins Bett p. 88 o Reconstruct ancestors May revolutionize genomic research Useful now for researchers, not typical genealogists Testing entire Y-DNA genome Big Y or mtdna. 50 SOURCES Guide to DNA Testing and Genetic Genealogy, Blaine Bettinger, 10/13/16 Paperback https://isogg.org/wiki/ - International Society of Genetic Genealogy (ISOGG) Wikipedia,org https://geneed.nlm.nih.gov/topic_subtopic.php? tid=15&sid=19 explains genetics. National Institute of Health (NIH) info Family Tree DNA Learning Center www.familytreedna.com/learn/ - interpreting tests Ancestry Academy - https://www.ancestry.com/academy/courses/recommended DNA Digest, Jewish Gen Tom s DNA doc, my blog 52 14

SOURCES DNA Digest, Jewish Gen various topics, questions Tom s Hirsch s website list helpful web sites o Jgsgo.org/membership/members only/tom Hirsch s Website Listy Jgsgo.org member blog useful tips, new ideas, books, etc. 53 CONCLUSIONS GOOD LUCK ON YOUR RESEARCH! QUESTIONS 54 15