Incorporating SeqStudio Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017 The world leader in serving science
Key Applications for Genome Editing Research Tissue disease research Gene therapy research Animal disease model research Stem cell research Transgenic crop research To study gene function To target gene mutation To target transgene addition for heritable modification To label endogenous genes Stable integration For tissue & cell engineering to produce novel functions 2
CRISPR/Cas Overview Types of genomic changes possible: Single nucleotide changes (SNPs) Precise deletions and insertions Imprecise deletions (for knock-outs) Deletions at multiple loci 3
Genome Editing Workflow & Thermo Fisher Products Design Guide RNA Transfect Cells Determine Editing Efficiency (Population) Establish Single Cell Clones Screen Clones for Edit Characterize Successful Edits GeneArt CRISPR Search and Design Tool GeneArt TALEN search and design tool Gibco Transfection Reagents Gibco Cell Growth media GeneArt CRISPR-Cas9 molecular tools GeneArt Enzymatic Cleavage Detection kit TOPO cloning & Sanger sequencing Sanger Sequencing & TIDE IonTorrent NGS Sequencing qpcr/dpcr Gibco Media TOPO cloning & Sanger sequencing Sanger Sequencing + MVF IonTorrent NGS Targeted Sequencing qpcr/dpcr IonTorrent NGS Whole Genome Sequencing Any other phenotypic analyses 4
Experience the New SeqStudio Genetic Analyzer The new SeqStudio Genetic Analyzer provides an integrated experience to put you back in control of your lab life all-in-one cartridge for easy set up and reduced hands-on time with the flexibility for both sequencing and fragment analysis in a single run. cloud-based connectivity options for remote monitoring, data transfer and analysis. run time of as little as 1 hour with fast turnaround time Get an all-new, state of the art experience in an incredibly affordable package. 5
Thermo Fisher Scientific Facilitating Genome Editing Designs Pre-designed GCD primer database CRISPR cloud design-to-order tool Custom GCD primer design Pre-defined KO libraries Single targets or 96 well format Identify the gene; place orders through the CRISPR/TAL design tool Custom grna libraries (KI and others: grna per target) Single targets or 96 well format Proof-of Concept experiment knockout mutations in HPRT gene Designed guide RNA to human HPRT and other genes Transfected HEK293 cells with grna and Cas9, grew primary culture. CE Sequenced to determine efficiency of editing. Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced Diluted to grow out single HEK293 colonies, CE sequenced DNA from single colonies 6
CRISPR Workflow with Sanger Sequencing Primary Screen Sequencing cultures or colonies with more than one sequence confirms edit, but difficult to confirm sequence of edit 7
CRISPR Workflow with Sanger Sequencing Primary Screen Brinkman et al., Nucl. Acids Res. (2014) 8
SeqStudio is compatible with TIDE software HPRT Forward strand RELA Forward strand HPRT Reverse strand RELA Reverse strand Mixed culture containing unpurified edited cells sequenced around site of edit Efficiency of editing: around 80% Efficiency of editing: around 20% 9
SeqStudio results are equivalent to legacy platforms RELA Forward - 3130 HPRT Forward - 3130 RELA Forward - 3500 HPRT Forward - 3500 RELA Forward - SeqStudio HPRT Forward - SeqStudio 10
CRISPR Workflow with Sanger Sequencing Primary Screen 1. 2. CRISPR/Guide RNA Complex Transfect cells with editing complex 3. Establish primary culture Extract DNA from primary culture, PCR amplify locus and subclone 4. Extract DNA from individual subclones 5. Sanger sequence individual subclones 11
SeqStudio sequencing data is equivalent to legacy platforms 3130 traces SeqStudio traces Data analyzed using Sanger QC application in the Thermo Fisher Cloud 12
Examples of Edits in Primary Transformant Culture GTAAACATTGAAGGGAGATGGAAGAAGGAACTCTAGCCAGAGTCTTGCATTTCTCAGTCCTAAACAGGGTAATGGACTGGGGCTGAATCACATGAAGGCAAGGT CAGATTTTTATTATTA 13
CRISPR/Cas Workflow Examples from Secondary Screen Sequence is homogeneous and monoclonal Sequence is heterogeneous and not derived from a single clone 14
SNP Detection in a Secondary Clone 15
Minor Variant Finder: a key innovation for detecting rare variants Minor Variant Finder software: 1. Determines background peaks in control sample run concurrently with test sample 2. Compares and removes background peaks from the test sample 3. Looks for variants at identical position in forward and reverse sequencing reactions 4. Calculates area under the peak to determine allele frequency 16
Conclusions Sanger sequencing by capillary electrophoresis can be used to determine efficiency of successful genome edits in primary transformation cultures. Sanger sequencing is an efficient method used to confirm successful genome edits in transformed cultures, as well as screening secondary clones for successful editing events. Minor variant finder software can be leveraged to determine frequency of SNP changes in clones isolated from secondary cultures Thermo Fisher Scientific has integrated the tools necessary for genome editing and downstream analysis 17
Acknowledgements Namritha Ravinder, Ph.D and her team Kamini Varma, Ph.D The GeneArt CRISPR design tool, Invitrogen reagents, Gibco reagents, and TOPO cloning kit described in this Presentation are for research use only. Not for use in diagnostic procedures. 2016 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified. 18