Supplemental Information for: A fail-safe mechanism in the septal ring assembly pathway generated by the sequential recruitment of cell separation amidases and their activators Nick T. Peters, Thuy Dinh, and Thomas G. Bernhardt * Department of Microbiology and Molecular Genetics Harvard Medical School 200 Longwood Avenue Boston, MA 02115 *To whom correspondence should be addressed: Thomas G. Bernhardt, Ph.D. Department of Microbiology and Molecular Genetics Harvard Medical School Armenise Building, Room 302A 200 Longwood Avenue Boston, Massachusetts 02115 Phone: (617) 432-6971 Fax: (617) 738-7664 e-mail: thomas_bernhardt@hms.harvard.edu Running title: Sequential recruitment of EnvC and AmiB to the division site
A1 A2 A3 DIC ZapA-mCherry FtsN-GFP Figure S1
DIC mcherry GFP A1 A2 A3 FtsN ZapA-mCherry FtsN-GFP B1 B2 B3 EnvC EnvC-mCherry ZapA-GFP C1 C2 C3 NlpD NlpD-mCherry ZapA-GFP D1 D2 D3 AmiC AmiB ZapA-mCherry AmiB- sf GFP E1 E2 E3 ZapA-mCherry AmiC-GFP Figure S2
Supplemental Figure Legends Figure S1. GFP-FtsN is recruited to septal rings following cephalexin treatment. Cells of HC284(attHKNP21) [zapa-mcherry (Plac::gfp-ftsN)] (A) were grown overnight in LB at 37 C. They were then diluted 1:100 in M9 maltose supplemented with 10 μm IPTG. Upon reaching an OD600 of 0.05, 10 μg/ml cephalexin was added. Cells were grown for 3-4 doublings and then imaged on 2% agarose pads made with 10 μg/ml cephalexin added to ensure consistent drug treatment. The GFP-FtsN fusion colocalized with ZapA-mCherry septal rings 61.6% (n=154) of the time. DIC is shown in panel 1, mcherry is shown in panel 2, and GFP is shown in panel 3. Bar equals 4 microns. Figure S2. FtsN, amidase, and LytM factor localization in the absence of cephalexin. Cells of HC284(attHKNP21) [zapa-mcherry (Plac::gfp-ftsN)] (A), NP32(attHKNP18) [ envc zapa-gfp (Plac::envC-mCherry)] (B), NP94(attHKTB314) [ΔnlpD zapa-gfp (Plac::nlpD-mCherry)] (C), NP90(attHKNP19) [ΔamiB zapa-mcherry (Plac:: ss dsba-amib-sfgfp)] (D), NP84 (atthknp16) [ΔamiC zapa-mcherry (Plac-m3::amiC-gfp)] (E), were grown overnight in LB at 37 C. Cultures were diluted 1:100 in M9 maltose plus 10 μm IPTG and grown at 30 C until they reached and OD600 between 0.4-0.6. Cells were then imaged on 2% agarose pads with DIC (panels 1), mcherry (panels 2), and GFP/sfGFP (panels 3). Bar equals 4 microns.
Table S1. Localization statistics for NlpD and AmiC. Strain Genotype #cells %cells w/ rings TB28(attHKTB314) TB145(attHKTB314) TB143(attHKTB314) TU217(attHKTB314) TB28 (atthknp16) TB137(attHKNP16) TB139(attHKTB314) TU217(attHKTB314) WT (Plac::nlpD-mCherry) nlpd (Plac::nlpD-mCherry) amic (Plac::nlpD-mCherry) amic nlpd (Plac::nlpD-mCherry) WT (Plac::amiC-gfp) amic (Plac::amiC-gfp) nlpd (Plac::amiC-gfp) amic nlpd (Plac::amiC-gfp) 121 54.4 112 49.1 103 42.7 104 64.4 167 21.6* 158 19.6* 118 18.6 125 20.0* *AmiC rings were only observed in deeply constricted cells.
Plasmid construction In all cases, PCR was performed using KOD polymerase (Novagen) according to the instructions. Restriction sites for use in plasmid constructions are italicized and underlined in the primer sequences given below. Plasmid DNA and PCR fragments were purified using the Qiaprep spin miniprep kit (Qiagen) or the Qiaquick PCR purification kit (Qiagen), respectively. To construct ptd80 [attλ cat laci q Plac::envC-mCherry], the Plac::envC-mCherry containing EcoRI-HindIII fragment of ptb316 [atthk022 bla laci q Plac::envC-mCherry] (7) was used to replace the corresponding Para::envC fragment of ptd25 [attλ cat Para::envC] (7). For ptd82 [atthk022 bla laci q Plac:: ss dsba-amib(23-191)-sfgfp], amib(23-191) was amplified with the primers 5ʼ-GTCAGGATCCGCGACGCTCTCTGATATTCAGGTTTC-3ʼ and 5ʼ- GTCACTCGAGTTTATCGCCAGTGTTAGCCGTCG-3ʼ. The resulting fragment was digested with BamHI and XhoI and used to replace the corresponding amib(23-445) fragment of ptb311 [atthk022 bla laci q Plac:: ss dsba-amib(23-445)-sfgfp]. pnp3 [atthk022 bla laci q Plac:: ss dsba-amib (23-445)-mCherry] was constructed in several steps. First ptu148 [atthk022 bla laci q Plac:: ss dsba-mcherry] was constructed by replacing the sfgfp containing AvrII-HindIII fragment of ptb282 [atthk022 bla laci q Plac:: ss dsba-sfgfp] (6) with an appropriately digested mcherry fragment amplified from ptu136 [atthk022 bla laci q Plac:: ss dsba-mcherry] (7) using the primers 5ʼ- GTCACCTAGGCAAGATCCGGCTGGTCTGTCCAAGGGCG-3ʼ and 5ʼ- GTCAAAGCTTGTCGACTTATTTGTACAGCTCATCCATGCCACC-3ʼ. ptu136 and ptu148 are similar vectors but have different cloning sites for the construction of exported N- or C-terminal
mcherry fusions, respectively. ptu190 [atthk022 bla laci q Plac:: ss dsba-amib (23-445)- mcherry] was made by inserting the amib containing BamHI-XhoI fragment from ptb311 into ptu148 digested with the same enzymes. pnp3 was then constructed by replacing the mcherry containing XhoI-HindIII fragment of ptu190 with mcherry amplified from ptu136 with the primers 5ʼ- GTCACTCGAGGGTCCGGCTGGTCTGTCCAAGGGCGAGGAGGATAACC-3ʼ and 5ʼ- GTCAAAGCTTGTCGACTTATTTGTACAGCTCATCCATGCCACC-3ʼ. pnp3 and ptu190 are identical except that the former codes for a shorter linker sequence (LEGPAGL) between AmiB and mcherry. The shorter linker yielded superior localization results relative to the longer linker (LEPYASAQPRQDPAGL) (data not shown). To construct pdy71 [atthk022 teta tetr laci q Plac::], the base vector for Tet R containing integration plasmids needed for experiments with cephalexin, several rounds of mutagenesis were required to remove XbaI, HindIII, EcoRI and NdeI sites from the teta tetr genes. The teta tetr cassette was amplified from a Tn10 containing strain using the primers 5ʼ- ATTCTAGATCTCTAAAGGGTGGTTAACTCGACATCTTGG-3ʼ and 5ʼ- ATTCTGCGGCCGCAGGCCAATTTATTGCTATTTACCGCGG-3ʼ. Then single primer site directed mutagenesis was used to eliminate XbaI (AATTAGGAATTAATGATGTCCAGATTAGATAAAAGTAAAGT), HindIII (CGTAAACTCGCCCAGAAGCTCGGTGTAGAGCAGCCTACATT), EcoRI (AAATAAAGTGATGTATACCGAGTTCGATTGCGTCTCAACCC), and NdeI (TTCGGCCTTGAATTGATCATCTGCGGATTAGAAAAACAACT) resulting in pdy71.
To construct pdy75 [atthk022 teta tetr arac Para:: ss dsba-amib], the Plac:: ss dsba-amib (23-445)-sfgfp containing BglII-HindIII fragment from ptb311[atthk022 bla laci q Plac:: ss dsbaamib(23-445)-sfgfp] (6) was used to replace the corresponding fragment of pdy71. To construct pnp16, the amic-gfp containing XbaI-HindIII fragment from ptb28 [bla laci q Plac::amiC-gfp] (2) replaced the corresponding fragment in phc583 [atthk022 teta tetr laci q Plac-m3::slmA]. The phc583 plasmid was generated by BgIII-HindIII digestion of the pdy75 backbone and replacing it with a corresponding fragment from phc531 [atthk022 bla laci q Placm3::slmA] (3). Plac-m3 is a synthetic lac promoter variant with a more consensus -10 element (TATGTT changed to TATATT). To construct pnp18 [atthk022 teta tetr laci q Plac::envC-mCherry], pnp19 [atthk022 teta tetr laci q Plac:: ss dsba-amib-sfgfp], and pnp20 [atthk022 teta tetr laci q Plac::nlpD-mCherry] the envc-mcherry, ss dsba-amib-sfgfp, or nlpd-mcherry containing XbaI-HindIII fragments from ptb316 [atthk022 bla laci q Plac::envC-mCherry] (7), ptb311 [atthk022 bla laci q Plac:: ss dsbaamib(23-445)-sfgfp] (6), or ptb314 [atthk022 bla laci q Plac::nlpD-mCherry] (7), respectively were used to replace the corresponding fragment of pmm60 [atthk022 teta tetr laci q Plac::ycfM-sfgfp]. To construct pmm60, the ycfm-sfgfp containing BgIII-HindIII fragment of pcb28 [atthk022 bla laci q Plac::ycfM-sfgfp] (5) was used to replace the corresponding fragment of pdy75. To construct pnp21 [atthk022 teta tetr laci q Plac::gfp-ftsN], the gfp-ftsn containing XbaI-HindIII fragment from pkp5 [attλ cat arac Para::gfp-ftsN] was used to replace the corresponding fragment of pmm60. The pkp5 plasmid was created by XbaI-HindIII digestion of ptb285 [attλ
cat arac Para::] (3) and inserting a corresponding fragment from ptu194 [atthk022 bla laci q Psyn135::mCherry-ZapA]. The ptu194 plasmid was generated by XbaI-HindIII digestion of ptu191 [atthk022 bla laci q Psyn135::gfp-ftsN] and inserting a corresponding fragment from pch201 [atthk022 bla laci q Plac::gfp-ftsN] (4). The ptu191 plasmid was created by EcoRI-SaII digestion of ptb265 [atthk022 bla laci q Para::] (7) and replaced with a corresponding fragment from pez4 [attλ cat arac Psyn135::gfp-zapA] (1).
REFERENCES 1. Bendezú F., C. Hale, T. Bernhardt, and P. de Boer. 2009. RodZ (YfgA) is required for proper assembly of the MreB actin cytoskeleton and cell shape in E. coli. EMBO J 28:193-204. 2. Bernhardt T. G., and P. A. J. de Boer. 2003. The Escherichia coli amidase AmiC is a periplasmic septal ring component exported via the twin-arginine transport pathway. Mol Microbiol 48:1171-1182. 3. Cho H., H. R. McManus, S. L. Dove, and T. G. Bernhardt. 2011. Nucleoid occlusion factor SlmA is a DNA-activated FtsZ polymerization antagonist. Proc Nat Acad Sci USA 108:3773-3778. 4. Hale C. A., and P. A. J. de Boer. 2002. ZipA is required for recruitment of FtsK, FtsQ, FtsL, and FtsN to the septal ring in Escherichia coli. J Bacteriol 184:2552-2556. 5. Paradis-Bleau C., M. Markovski, T. Uehara, T. J. Lupoli, S. Walker, D. E. Kahne, and T. G. Bernhardt. 2010. Lipoprotein cofactors located in the outer membrane activate bacterial cell wall polymerases. Cell 143:1110-1120. 6. Uehara T., K. R. Parzych, T. Dinh, and T. G. Bernhardt. 2010. Daughter cell separation is controlled by cytokinetic ring-activated cell wall hydrolysis. EMBO J 29:1412-1422. 7. Uehara T., T. Dinh, and T. G. Bernhardt. 2009. LytM-domain factors are required for daughter cell separation and rapid ampicillin-induced lysis in Escherichia coli. J Bacteriol 191:5094-5107.