The Human Genome Project
The Human Genome Project Began in 1990 The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease. The true payoff from the HGP will be the ability to better diagnose, treat, and prevent disease. --- Francis Collins, Director of the HGP and the National Human Genome Research Institute (NHGRI)
The genome is our Genetic Blueprint Nearly every human cell contains 23 pairs of chromosomes 1-22 and XY or XX XY = Male XX = Female Length of chr 1-22, X, Y together is ~3.2 billion bases (about 2 meters diploid)
The Genome is Who We Are on the inside! Chromosomes consist of DNA molecular strings of A, C, G, & T base pairs, A-T, C-G Information coded in DNA Genes DNA sequences that encode proteins less than 3% of human genome
The Human Genome Project Until the early 1970 s, DNA was the most difficult cellular molecule for biochemists to analyze. DNA is now the easiest molecule to analyze we can now isolate a specific region of the genome, produce a virtually unlimited number of copies of it, and determine its nucleotide sequence overnight. Molecular Biology Of The Cell. Alberts et al. 491-495
The Beginning of the Project Most the first 10 years of the project were spent improving the technology to sequence and analyze DNA. Scientists all around the world worked to make detailed maps of our chromosomes and sequence model organisms, like worm, fruit fly, and mouse.
The Human Genome Project At the height of the Human Genome Project, sequencing factories were generating DNA sequences at a rate of 1000 nucleotides per second 24/7. Technical breakthroughs that allowed the Human Genome Project to be completed have had an enormous impact on all of biology.. Molecular Biology Of The Cell. Alberts et al. 491-495
The Challenges were Overwhelming First there was the Assembly The DNA sequence is so long that no technology can read it all at once, so it was broken into pieces. There were millions of clones (small sequence fragments). The assembly process included finding where the pieces overlapped in order to put the draft together. 3,200,000 piece puzzle
The Human Genome Project Goals: identify all the approximate 30,000 genes in human DNA, determine the sequences of the 3 billion chemical base pairs that make up human DNA, store this information in databases, improve tools for data analysis, transfer related technologies to the private sector, and address the ethical, legal, and social issues (ELSI) that may arise from the project. Milestones: 1990: Project initiated as joint effort of U.S. Department of Energy and the National Institutes of Health June 2000: Completion of a working draft of the entire human genome (covers >90% of the genome to a depth of 3-4x redundant sequence) February 2001: Analyses of the working draft are published April 2003: HGP sequencing is completed and Project is declared finished two years ahead of schedule http://doegenomes.org http://www.sanger.ac.uk/hgp/overview.shtml U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
UCSC put the human genome sequence on the web July 7, 2000 UCSC put the human genome sequence on CD in October 2000, with varying results Cyber geeks Searched for hidden Messages, and GATTACA
The Completion of the Human Genome Sequence June 2000 White House announcement that the majority of the human genome (80%) had been sequenced (working draft). Working draft made available on the web July 2000 at genome.ucsc.edu. Publication of 90 percent of the sequence in the February 2001 issue of the journal Nature. Completion of 99.99% of the genome as finished sequence on July 2003.
What does the draft human genome sequence tell us? By the Numbers The human genome contains 3 billion chemical nucleotide bases (A, C, T, and G). The average gene consists of 3000 bases, but sizes vary greatly, with the largest known human gene being dystrophin at 2.5 million bases. Smallest is trna gene at 76bp! The total number of genes is estimated at around 30,000--much lower than previous estimates of 80,000 to 140,000. Almost all (99.9%) nucleotide bases are exactly the same in all people. The functions are unknown for over 50% of discovered genes. http://doegenomes.org U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
What does the draft human genome sequence tell us? How It's Arranged The human genome's gene-dense "urban centers" are predominantly composed of the DNA building blocks G and C. In contrast, the gene-poor "deserts" are rich in the DNA building blocks A and T. GC- and AT-rich regions usually can be seen through a microscope as light and dark bands on chromosomes. Genes appear to be concentrated in random areas along the genome, with vast expanses of noncoding DNA between. Stretches of up to 30,000 C and G bases repeating over and over often occur adjacent to gene-rich areas, forming a barrier between the genes and the "junk DNA." These CpG islands are believed to help regulate gene activity. Chromosome 1 has the most genes (2968), and the Y chromosome has the fewest (231). http://doegenomes.org U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
The human genome How It's Arranged The human genome's gene-dense "urban centers" are predominantly composed of the DNA building blocks G and C. In contrast, the gene-poor "deserts" are rich in the DNA building blocks A and T. GC- and AT-rich regions usually can be seen through a microscope as light and dark bands on chromosomes. Genes appear to be concentrated in random areas along the genome, with vast expanses of noncoding DNA between. Stretches of up to 30,000 C and G bases repeating over and over often occur adjacent to gene-rich areas, forming a barrier between the genes and the "junk DNA." These CpG islands are believed to help regulate gene activity. Chromosome 1 has the most genes (2968), and the Y chromosome has the fewest (231). http://doegenomes.org U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
The Wheat from the Chaff What does the draft human genome sequence tell us? Less than 2% of the genome codes for proteins. Repeated sequences that do not code for proteins ("junk DNA") make up at least 50% of the human genome. Repetitive sequences are thought to have no direct functions, but they shed light on chromosome structure and dynamics. Over time, these repeats reshape the genome by rearranging it, creating entirely new genes, and modifying and reshuffling existing genes. The human genome has a much greater portion (50%) of repeat sequences than the mustard weed (11%), the worm (7%), and the fly (3%). http://doegenomes.org U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
What does the draft human genome sequence tell us? How the Human Compares with Other Organisms Unlike the human's seemingly random distribution of gene-rich areas, many other organisms' genomes are more uniform, with genes evenly spaced throughout. Humans have on average three times as many kinds of proteins as the fly or worm because of mrna transcript "alternative splicing" and chemical modifications to the proteins. This process can yield different protein products from the same gene. Humans share most of the same protein families with worms, flies, and plants; but the number of gene family members has expanded in humans, especially in proteins involved in development and immunity. Although humans appear to have stopped accumulating repeated DNA over 50 million years ago, there seems to be no such decline in rodents. This may account for some of the fundamental differences between hominids and rodents, although gene estimates are similar in these species. Scientists have proposed many theories to explain evolutionary contrasts between humans and other organisms, including those of life span, litter sizes, inbreeding, and genetic drift. http://doegenomes.org U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
What does the draft human genome sequence tell us? Variations and Mutations Scientists have identified about 3 million locations where single-base DNA differences (SNPs) occur in humans. This information promises to revolutionize the processes of finding chromosomal locations for disease-associated sequences and tracing human history. The ratio of germline (sperm or egg cell) mutations is 2:1 in males vs females. Researchers point to several reasons for the higher mutation rate in the male germline, including the greater number of cell divisions required for sperm formation than for eggs. http://doegenomes.org U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
What does the draft human genome sequence tell us? Led to the discovery of whole new classes of proteins and genes, while revealing that many proteins have been much more highly conserved in evolution than had been suspected. Provided new tools for determining the functions of proteins and of individual domains within proteins, revealing a host of unexpected relationships between them. Molecular Biology Of The Cell. Alberts et al. 491-495
What does the draft human genome sequence tell us? By making large amounts of protein available, it has yielded an efficient way to mass produce protein hormones and vaccines Dissection of regulatory genes has provided an important tool for unraveling the complex regulatory networks by which eukaryotic gene expression is controlled. Molecular Biology Of The Cell. Alberts et al. 491-495
The Project is not Done Next there is the Annotation: The sequence is like a topographical map, the annotation would include cities, towns, schools, libraries and coffee shops! So, where are the genes? How do genes work? And, how do scientists use this information for scientific understanding and to benefit us?
What do genes do anyway? We only have ~19,000 genes, so that means that each gene has to do a lot. Genes make proteins that make up nearly all we are (muscles, hair, eyes). Almost everything that happens in our bodies happens because of proteins (walking, digestion, fighting disease). OR OR Eye Color and Hair Color are determined by genes
Of Mice and Men: It s all in the genes Humans and Mice have about the same number of genes. But we are so different from each other, how is this possible? Did you say cheese? Mmm, Cheese! One human gene can make many different proteins while a mouse gene can only make a few!
Genes are important By selecting different pieces of a gene, your body can make many kinds of proteins. (This process is called alternative splicing.) If a gene is expressed that means it is turned on and it will make proteins.
The UCSC Genome Browser
The browser takes you from early maps of the genome...
... to a multi-resolution view...
... at the gene cluster level...
... the single gene level...
... the single exon level...
... and at the single base level caggcggactcagtggatctggccagctgtgacttgacaag caggcggactcagtggatctagccagctgtgacttgacaag
The Continuing Project Finding the complete set of genes and annotating the entire sequence. Annotation is like detailing; scientists annotate sequence by listing what has been learn experimentally and computationally about its function. Proteomics is studying the structure and function of groups of proteins. Proteins are really important, but we don t really understand how they work. Comparative Genomics is the process of comparing different genomes in order to better understand what they do and how they work. Like comparing humans, chimpanzees, and mice that are all mammals but all very different.