RNA genes Functional non-coding RNAs (ncrna) Jan 31 st 2018.
After human genome sequencing it became obvious that human genome consists of many non-protein coding genes, genes that code for different RNAs
Main components of the Human genome approximately 20,000 protein-coding genes (1.5%), 26% of the human genome are introns non-coding RNA molecules regulatory DNA sequences (up to 20%), LINEs, SINEs the sequences for which (so far) no function has been elucidated.
* (ENCODE project- Encyclopedia of DNA Elements (started 2003.) identification of functional elements in the human genome) RNA genes Unexpectedly large group of (non-coding) ncrnas At least 80% of human genome has determined function (ENCODE *)! ~ 21000 protein coding genes ~ 8500 RNA coding genes Most of the genome is transcribed from both DNA chains multigenic transcription
Before HGP known RNA genes Ribosomal RNA - rrna Transfer RNA - trna ~ 1000 genes ~ 130 genes small RNAs parts of ribonukleoproteins RNA splicing, X-kromosom inaktivation, imprinting, telomeraze
mrna
Human genes complexity
Ribosomal RNA, rrna Transfer RNA, trna RNA genes Small nuclear RNA, snrna Small nucleolar RNA, snorna Small Cajal body RNA, scarna RNA ribonucleases Small cytoplasmic RNA Micro RNA, mirna Piwi-binding RNA, pirna Endogenic small interfering RNA, endosirna Long non-coding regulatory RNA
Ribosomal RNA genes 2 mitohondrial rrna (12S i 16S) 4 cytoplasmic rrna (28S, 5.8S, 5S, 18S) 5S - 16 gene copies on chromosome 1. (and a lot of pseudogenes) 28S, 5.8S i 18S unique multigenic transcription unit (several megabases long) Over 40 repeats of more than 100 rrna genes on 5 different acrocentric chromosomes
18S 5.8S 28S 18S 5.8S 28S Ribosome
Transfer RNA genes 4 3 = 64 anticodons (for 20 aminoacids and STOP codons) 22 mitohondrial trnas = 22 mitohondrial genes Nuclear trna over 500 genes mostly on chromosome 1 and 6 49 gene groups with diferent anticodon specificity (61 codons for aa and 3 for stop) Weak correlation between number of genes and aa abundance in proteins e.g. Cys (2,25%) = 30 genes Pro (6.10%) = 21 genes
snrna i scarna genes 60-360 nt long Help gene expression on the level of posttranscriptional processing - SPLICEOSOME U1-U6 snrna (uridine rich) Part of ribonucleoproteins (e.g. telomerase) ~100 genes scattered throughout the genome
mirna 20-21 nt long First described in C.elegans & Drosophila Evolutionary conserved Gene expression control and regulation Synthesized as longer precursors by RNA polymeraze III Part of RNA interference process (short dsrnas: mirnas and shrna are transcribed from DNA, and cut with Dicer to sirna (20-21 nt). Also, synthetic sirna can be introduced into cells.)
RNA interference
RNA interference Natural way of gene expression regulation Postranscriptional silencing of protein synthesis More than 1000 genes Craig Mello & Andrew Fire 1998. (NP 2006)
RISC RNA induced silencing complex http://www.youtube.com/watch?v=2dl7sh_udks
RNAi applications gene knockdown/ silencing Biotehnology Functional genomics Medicine Drug discovery
Antiviral therapy RNAi in medicine Herpes simplex, hepatitis, HIV Neurodegenerative diseases Huntington s disease Tumors Silencing of genes responsible for cellular proliferation Problem! 1. off-target effects (= nonspecific binding of sirna to mrna) 2. sirna delivery into cells
Crispr/Cas9 gene editing Procariotic (bacterial) immune system defense against phages (viruses) When applied in eucariotic cells, CRISPR-Cas9 enables editing parts of the genome by removing, adding or altering sections of the DNA sequence currently the simplest, most versatile and precise method of genetic manipulation personalized medicine
Crispr/Cas9 technology https://www.youtube.com/watch?v=4ykfw2kza5o
Functional genomics & proteomics
What is genomics? All about genes/dna of one organism Analysis of total DNA (coding and non-coding) Allele and locus relationships Chromosomal gene structure 23
A map of human genome: Craig Venter 24
What is functional genomics? Connects gene/genome with transcribed product (protein or RNA) What is proteomics? Total set of all proteins in one organism 25
Proteome All proteins of one genome 1 genome = many proteomes Why? Developmental stages, different tissues, posttranslational modifications, proteolitic processing, alternative splicing, splicing,... 1 cell = 100.000 proteins from 21.000 genes Proteomics is by far more complicated than genomics 26
Protein interaction network 27
Proteome project goals To identify all the proteins of a system To discover new interactions and connections between proteins - network To define 3D structures of proteins/protein complexes drug design = better therapy 28
The Human Proteome Project (HPP) Mass Spectrometry (MS) Antibodies (Abs) Knowledgebase (KB)
Methods Microarray Gene expression analysis Proteinprotein interactions Loss-offunction (RNAi, KO) Mass spectrometry
Bioinformatics Biological/experimental data Computer analysis 32
A lot of new information generated daily
With bioinformatics tools we can...assemble results
...map and predict genes
...compare and align genes/proteins
... search for sequence similarities hard for a human eye, easy for a computer ccctcctgcatgaaatgatacatgccttgcgcagca atgccatcggttaaagcgcatgcgcaagatgagct attgcggaagtgaggggagggagaggccgagag aaatcggtactgcgcatgaaccgagcgtgacgttg aggtgaaataaccggcaaagagtaaaggctgaa actagcttcctgaaagcttcgtagggcccgagccct gtgagcccaggttctgcgcccactaggaggtgtcat gctgactgctaaagccctagaatcttggcttcggcgt ttggggtaagctccgttctcgttctcaagcgcgtttcc gcgaactctcgcgggattgacgggccgtctcgaga gccggcatctcctaggagctagtcctggtcctcggct aggcggcttggggtcgcggcgtaactggggagcc agcctgacgccggcggaccccgcctgtgatcctgg caacgatggatgatgacttgatgttggcactgcggct tcaggaggagtggaacttgcaggaggcggagcg cgatcatgcccaggagtccctgtcgctagtggacgc gtcgtgggagttggtggaccccacaccggacttgc aaggcaaaactaggaaaggaaccagtattggcc gctgcgcagcaatgccatcggttaaagcgcatgcg caagatgagctattgcggaagtgaggggagggag aggccgagagaaatcggtactgcgcatgaaccga gcgtgacgttgaggtgaaataaccggcaaagagt aaaggctgaaactagcttcctgaaagcttcgtaggg cccgagccctgtgagcccaggttctgcgcccacta ggaggtgtcatgctgactgctaaagccctagaatctt ggcttcggcgtttggggtaagctccgttctcgttctca agcgcgtttccgcgaactctcgcgggattgacggg ccgtctcgagagccggcatctcctaggagctagtcc tggtcctcggctaggcggcttggggtcgcggcgtaa ctggggagccagcctgacgccggcggaccccgc ctgtgatcctggcaacgatggatgatgacttgatgtt ggcactgcggcttcaggaggagtggaacttgcagg aggcggagcgcgatcatgcccaggagtccctgtc gctagtggacgcgtcgtgggagttggtggacccca
... perform multiple alignment analysis
...compare throughout the evolution
...predict different features and properties
...model
Databases!
ENTREZ NCBI (USA)
ENSEMBL EBI (UK)
DDBJ (Japan)
Data mining