BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab Week 5 Analysis of pgem recombinant clones using PCR Clonecheck to determine size of insert; select clones for further analysis Week 6 Plasmid preps of selected clones; restriction digests Week 7 Gel Analysis of digests Week 8 Summaries of clone analyses due to CT at 3pm on 5/21 Table of Contents Week 5 (5/1, 2&3) Lab Activities Week 6 (5/8, 9&10) Lab Activities Week 7 (5/15, 16 &17) Appendix 1 Prelab Assignments Don t forget to set up colony grid the day before lab each student must do this PCR-based Clone assessment Prelab Assignments Don t forget to set up overnight cultures the day before lab Plasmid preps & quantitation Analysis of clones: restriction digests Gel analysis of restriction digests Map showing T7 & SP6 primer binding sites on pgem pgs 1-2 pg 1 pg 3-4 pg 2 pg 3 pgs 5&6 pg 7 Week 5 Prelab assignment due to CT at the beginning of lab be sure to tape a copy of this assignment in your notebook or work this up in your notebook and give me a READABLE photocopy Work up a written plan/diagram for analyzing your clones (see more explicit instructions below). Week 5 Other prelab assignments Read about PCR online or in one of your textbooks Work up PCR Cloncheck protocol in your lab notebook including recipe for MasterMix See prelab assignments for Week 6 SET UP GRID OF COLONIES (instructions will be given in lecture) the day BEFORE YOUR LAB. Grid at least 20 white colonies a 4 blue colonies.incubate overnight at 37 o C. Store at 4 o C.
Week 5 prelab assignment: Plan of action for Analysis of subclones by restriction enzyme digests. Due to CT at beginning of LAB 5 Your plan should include the specific restriction digestions that you will do and the predicted results. NOTE: I want to see a plan of action. You don t need to have specific recipes written out for the digests or the gels until next week. Each student will eventually analyze two clones. You will only be analyzing colonies that contain a recombinant plasmid with the smaller insert, which you will identify using the PCR-based ClonCheck protocol (below) There is more than one reasonable way to analyze your clones. Don t feel like you need to do the same experiment as your lab partner. Using restriction enzyme digests, you will analyze two clones to confirm their identity and to determine the orientation of the insert fragment relative to the pgem vector. Generate restriction maps of the insert and pgem vector see list of available enzymes below. Don t forget that the insert fragments were generated by digestion of the pct704 plasmid. You will need your plasmid map to do this assignment. Draw maps of the 2 possible clones that you generated assuming that your recombinant molecules consists of a single 1.0 kb insert fragment (this is the gene-specific portion of the cdna in pct704) and one pgem vector molecule. What single and/or double digests would be useful for this analysis? NOTE: propose at two different ways of addressing this question. For each digest, diagram the predicted results and determine if it will give you the information you need. The following restriction enzymes are available to you: Sal I, Pst I, Xho I, Eco RI, Hind III, Bgl II, Bam HI, HaeIII, Dra I and Ssp I 2
WEEK 5 in LAB Screening Inserts by PCR Each white colony of E. coli should carry a homogenous pool of recombinant plasmids combined with one of the Bgl II-Bam HI fragments. As we discussed earlier, there are also other possibilities. We will use PCR to amplify across the pgem multiple cloning site and then analyze the products on an agarose gel The size of the PCR product will confirm that the colony carries a recombinant plasmid and will tell us which fragment was cloned. Consult Appendix A and information on pgem posted on web site to calculate the size of the PCR product expected given no insert (a fake white), the 1.0kb insert or the 1.3 kb insert. Overview of Clonecheck protocol NOTE: each student will set up his/her own PCR reactions Read through PCR protocol. Work up a master mix that contains all the components of the reaction (except the E. coli cells). [Master mix template is on next page.] You will be running 8 PCR reactions, so make up a master mix for 9 reactions. Have your lab partner doublecheck your calculations Carefully put together the master mix and MIX thoroughly. Keep on ice. Dispense 20 µl of the mix into each of 8 [0.2 ml] strip tubes Take a sterile pipettip, touch it to the top of a colony and then dip it into the PCR tube. Briefly swirl the toothpick to release the bacteria. NOTE that this technique does not require lots of cells in fact, too many bacteria can inhibit the reaction. Keep on ice until placed in the thermocycler. Technical details concerning the whys, wherefors and hows of primer design, cycling strategies and so on will be explored in the next lab exercise. Reaction Count: Analyze 6 different white colonies, one blue colony and omit cells from one PCR reaction (why?). 3
Reagent (Stock conc.) H 2 0 vol per Rxns vol per 20 µl Rxn final conc 10X PCR Buffer 1X (Promega) dntp's (2.5mM) 0.25mM Mg ++ (25mM) 2.5mM BSA (10mg/ml) 0.2 µg primer 1 (50 µm) 0.5µM primer 2 (50 µm) 0.5µM Taq 0.5 µl Notes: 10X Promega buffer includes Triton X-100. This is crucial for cell lysis. The recipe for this buffer will b available in the lab. Be sure to record it in your lab notebook. Cycling Conditions: 94ºC 8 min 94ºC 15 sec *45-55ºC 30-60sec 30 cycles 72ºC 30-60 sec 72ºC 5 min 8ºC hold * use 45 annealing for T7/M13 (Tm of these primers is 50. What is Tm?) * use 60 sec for annealing and extension times 4
WEEK 6 PRELAB LAB ACTIVITIES Week 6 PRELAB ASSIGNMENT #1: due at the beginning of lab Assessment of transformation efficiency. You will probably have time to do this during lab (Week 5) 1. Count colonies on your positive (pgem) control plate and calculate the number of transformants per ng of pgem DNA. Submit your raw data (including % white colonies) and calculations (in some sort of readable form). Circle your answer. 2. Select one of your plates with colonies transformed with the ligation mix and do the same as indicated in #1. Week 6 PRELAB ASSIGNMENT #2: due at the beginning of lab 3. In your lab notebook work up (to the extent that you can) the specific protocols for prepping and digesting your plasmid DNA. Use 5X excess of enzyme or 0.5 µl whichever is a larger volume. NOTE: DON T forget that you should only be analyzing colonies that contain a recombinant plasmid with the smaller insert. At least two days before your next scheduled lab: Each student should streak out two colonies (with 1.0kb insert) from the grid plate on L + amp plates. Add IPTG and Xgal to the plates before you streak. Divide one plate in half and streak two colonies per plate. See Appendix 4 of previous handout for instructions. If you haven t done this before, get a lesson in microbiological streaking from CT or your TA or a knowledgeable fellow student. To do the afternoon or evening before your next scheduled lab Each student should set up overnight cultures of one colony from each streak (above). Each colony should be inoculated into 5 ml of L broth + 100 µg/ml ampicillin in a 15 ml screw-capped plastic tube. Shake at 37 o overnight. (The tube should be horizontal.) 5
WEEK 6 IN LAB Plasmid preps: Each student should prepare and analyze two different recombinant plasmids Run a minigel to estimate the concentration of plasmid in the eluate from the Qiagen column. Run undiluted and a couple dilutions of your plasmid prep. We will provide a reference sample of plasmid of known concentration (determined by an A 260 reading) to run on the minigel. Week 6 Perform restriction digests & (Week 7) analyze using agarose gel electrophoresis). When you run your gels, be sure to run uncut plasmid DNA and size standards that cover the full range of fragment sizes that you will see. ALSO: add ethidium bromide (0.5 microgram/ml final) to gel and to tank on + side of gel rig OR post-stain gel. Monday May 21 at 3pm: Workup of data for each subclone due to CT ABSOLUTELY NO LATE SUBMISSIONS WILL BE ACCEPTED (i) Name your subclones [Plasmid names typically start with a lower case p, usually followed by uppercase letters (somebody s initials or something clever) and a number.] (ii) Write out a short summary of what you know about your subclone (iii) Draw a map of the insert and vector, indicating the orientation of the insert. Be sure to include a scale and relevant restriction sites. (iv) Attach a labelled photo of your gel 6
Appendix 1: Primer sequences: T7 TAATACGACTCACTATAGGG SP6 ATTTAGGTGACACTATAGAA Position of T7 and SP6 primers relative to the the BamHI site of pgem 7