Inhibition of Hepatitis C Virus Replication by, A Potent C-Nucleoside Monophosphate Prodrug Running Title: In Vitro Pharmacology of Authors: Joy Y. Feng et al. Supplementary Information Table S1. RNA primer and template used in nucleotide incorporation and chaintermination assays Oligonucleotides Sequences a Primer (GpC) 5 -GC-3 Template (R16) 3 -CGGAAGAGAUCAACAA -5 a The underlined letter U in the template sequence denotes the location of the first incoming ATP analog. Table S2. Viruses and cell lines used in the antiviral screening of Virus a Virus Strain Cell Line (Assay duration) BVDV NADL BVDV replicon/huh-7 b (3 days) NADL 1 MDBK (7 days) West Nile virus NY-99 Vero (5 days) Dengue virus Type 2, New Guinea C Vero E6 (7 days) Yellow fever virus 17D Hela (10 days) Human rhinovirus Type 1A H1-HeLa (5 days) Type 1B Type 10 MRC-5 (7 days) H1-HeLa (5 days) Coxsackie A7 or A21 MRC-5 (7 days) RSV A2 Hep-2 (4 days) Parainfluenza HPIV-3, strain C 243 Vero (7 days) Influenza A H3N2/Hong Kong/8/68 MDCK (5 days) H1N1/Puerto Rico/8/34 MDCK (7 days) Vaccinia NYCBH BSC40 (3 days) HIV HIV-1 IIIB MT-2 (5 days) HBV pcmvhbv AD38 c (4 days) a BVDV replicon, human rhinovirus (HRV, 1A and 10), RSV, influenza A (H3N2), HIV, and HBV were tested in-house. All of the other viruses were tested by Southern Research Institute (Birmingham, Alabama) with the exception of Vaccinia virus which was tested by IBD Bioservices (Gaithersberg, MD).
b The level of BVDV replicon was measured by firefly luciferase activity using a commercial firefly luciferase assay (Promega, Madison, WI). c AD38 cells are HepG2 cells stably transfected with pcmvhbv as described previously (1). Mitochondrial DNA content. Quantification of mtdna was achieved by amplification of a fragment of the mitochondrial specific cytochrome b gene using the following primers and probes: Forward primer: 5 -CCTTCCACCCTTACTACACAATCAA-3 Reverse primer: 5 -GGTCTGGTGAGAATAGTGTTAATGTCA-3 Probe: 5 -FAM-ACGCCCTCGGCTTAC-BHQ1-3 Amplification reactions for the quantification of mitochondrial and chromosomal DNA were performed independently using approximately 25 ng of total DNA in a volume of 20 μl. The relative amount of mtdna in treated samples was determined using a relative quantification method based upon the 2 - C T formula (2). HCV GT2a Virus Titer Determination (TCID 50 assay). Lunet-CD81 cells were seeded at a concentration of 4 10 3 cells per well in 96-well plates in a total volume of 100 µl complete DMEM per well. On the next day, three-fold serial dilutions of virus-containing supernatant were prepared, and 100 µl of each dilution was added to four wells per dilution. Three days later, cells were fixed and stained for the presence of NS5A by indirect immunofluroescence (as described below). Wells positive for NS5A protein were counted and virus titers (TCID 50 /ml) were calculated based on the method of Reed and Muench (3). Genotypic Analysis of Resistant Viruses. Total RNA was isolated from cell culture supernatants using the Virus RNA QIAamp kit (Qiagen, Valencia, CA) as recommended by the manufacturer. The cdna of the entire NS5B coding sequence was synthesized using MonsterScript 1st-Strand cdna Synthesis Kit (Epicentre Biotechnologies, Madison, WI) and a gene specific primer GC-v9925R-2a with the following sequence: 5 CTA TGG AGT GTA CCT AGT GTG TGC 3, as recommended by the manufacturer. The synthesized cdna was subsequently amplified by PCR using the primers 7513NF- 2a and 9463NR-2a (Table S3) and a High Fidelity Platinum PCR SuperMix (Invitrogen, Carlsbad, CA). The PCR products were sequenced by Elim Biopharmaceuticals Inc. (Hayward, CA) using the primers listed in Table S4. All PCR and DNA sequencing primers were synthesized by Elim Biopharmaceuticals. Changes in amino acid residues were identified using Vector NTI Advance 10 software (Invitrogen) by comparing the NS5A protein sequences between drug-selected and wild-type viruses. TABLE S3. PCR primers used for genotypic analysis of the NS5B gene 7513NF-2a AGACAGGTTCCGCCTCCTCT 9463NR-2a GTGTACCTAGTGTGTGCCGCTCTA 2
Table S4. Sequencing primers used for genotypic analysis of the NS5B gene 7513NF-2a AGACAGGTTCCGCCTCCTCT 7824R-2a GAAGCTCTACCTGATCAGACTCCA 7839F-2a CAAGTGCTCGACGCCCATTATG 8081F-2a ATGGCCAAAAATGAGGTGTTCTGC 8188R-2a GGCCATTTTCTCGCAGACCCGGAC 8210F-2a GCTTCCTCAGGCGGTAATGG 8477F-2a GGTCAAACCTGCGGTTACAGACGTTG 8608F-2a TGGTATGCGGCGATGACCTAG 9070F-2a GGCTTGACGCCTTTTCTATG Genotypic Analysis of Resistant Replicons Total RNA was extracted from drug-resistant or wild-type replicon cells using an RNeasy Mini kit (Qiagen, Valencia, CA). The cdna of the entire NS5B coding sequence was synthesized using MonsterScript 1st-Strand cdna Synthesis Kit (Epicentre Biotechnologies, Madison, WI) and a gene specific primer GC-v9799R-1b with the following sequence: 5 TAG ATA GAT GCC TAC CCC T 3, as recommended by the manufacturer. The synthesized cdna was subsequently amplified by PCR using the primers 7636F-1b and 9459R-1b (Table S5) and a High Fidelity Platinum PCR SuperMix (Invitrogen, Carlsbad, CA). The PCR products were sequenced by Elim Biopharmaceuticals Inc. (Hayward, CA) using the primers listed in Table S5. All PCR and DNA sequencing primers were synthesized by Elim Biopharmaceuticals. Changes in amino acid residues were identified using Vector NTI Advance 10 software (Invitrogen, Carlsbad, CA) by comparing the NS5B protein sequences between drug-selected and wild-type replicons. Table S5. RT-PCR and PCR primers used for genotypic analysis of the NS5B gene fragment. RT-PCR primers 7636F-1b GAT CTC AGC GAC GGG TCT TGG TC 9459R-1b CCT ATT GGC CTG GAG TGT TTA GCT C Sequencing primers 7576F-1b TCT TGG TCT ACC GTG AGC GAG GAG GC 7590F-1b GAG GAG GCy AGT GAG GAC GTC G 7981F-1b CTC CGT GTG GAA GGA CTT GCT GGA 8330F-1b GAG TCA ATC TAC CAA TGT TGT GAC 8629F-1b CGA GTC TTC ACG GAG GCT ATG AC 9021F-1b CTT AGC GCA TTT TCA CTC C 7960R-1b GTC TTC CAG CAA GTC CTT CCA CAC GG 8973R-1b GTC GTT GAA TGA TCT GAG GTA 9204R-1b ACG CAG CCG GGA TTG GAG TGA G 9320R-1b ACA GAA AGT AGG AGT AGG CAC 3
Table S6. Genotypic changes identified in NS5B gene after selection with, 2 CMeA, or 2 CMeC in genotype 2a infectious virus a Drug Conc. Select-1 Select-2 Select-3 Select-4 2 CMeA 2 CMeC 3 x EC 50 No mutations 6 x EC 50 b 10 x EC 50 M289V M289V M289V M289L 60 x EC 50 M289V M289V M289V V421A M289L a Silent mutations were not listed b indicates no selection performed at the indicated drug concentration Table S7. Phenotypic analyses of individual NS5B mutations against in genotype 2a antiviral activity assays NI EC 50 ( M) Select-1 Select-2 EC 50 Fold Resistance a Select-3 Select-4 2 CMeA 6x 2 CMeC M289V M289V M289V M289L 0.33 5.1 4.5 3.7 4.8 36.6 28.7 2 CMeA 0.41 3.5 3.0 2.4 4.2 33.2 32.4 2 CMeC 1.7 1.3 1.5 1.2 1.6 22.5 15.5 a Fold resistance is calculated as the ratio of mutant virus EC 50 to wild-type virus EC 50 6x 4
References 1. Ladner S, Otto M, Barker C, Zaifert K, Wang G, Guo J, Seeger C, King R. 1997. Inducible expression of human hepatitis B virus (HBV) in stably transfected hepatoblastoma cells: A novel system for screening potential inhibitors of HBV replication. Antimicrob Agents Chemother 41:1715-1720. 2. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif 25:402-408. 3. Reed LJ, Muench H. 1938. A simple method of estimating fifty per cent endpoints. Am J Hygiene 27:493-497. 5