Name: attempt# Final Review: Biotech Section GENE MUTATIONS 1. Define mutation: 2. Define gene mutation: 3. What are the two categories of gene mutations? 4. Label the diagram with the different types of gene mutations. THE CAT RAN FAR THE CAT RAN FAR THE CAT RAN FAR THE CAA TRA NFA R THE CTT RAN FAR THE CAT ANF AR 5. What happens to the amino acid sequence in additions/insertions and deletions. 6. Why is a point mutation less likely to create a harmful mutation than a frameshift mutation? 7. Define chromosomal mutation 8. Label the pictures with the different types of chromosomal mutations. BIOTECHNOLOGY TOOLS 1. Define Genetic engineering 2. What is a genome?
3. What is a restriction Enzyme? 4. What is the DNA sequence called where a restriction enzyme cuts? 5. Where did Restriction Enzymes originate from? 6. Label whether each restriction enzyme will create sticky ends or blunt ends? 7. Please identify the recognition sites for the following RE. Put a box around the recognition sites in the DNA sequence and arrows to indicate where the cuts will occur. Restriction enzyme BamHI: ATCGGATCCTGTCGACGCCAATAGCTGTCGACTAGCTCCATTGTCA TAGCCTAGGACAGCTGCGGTTATCGACAGCTGATCGAGGTAACAGT 8. Define recombinant DNA and draw and label a diagram. 9. What are the 6 steps of creating functional recombinant DNA (be sure to look at your notes so you get the correct ones) 10. What are transgenic organisms? 11. Why is bacteria a useful tool in genetic engineering?
12. Define plasmid: 13. Why are plasmids good for use in biotechnology? 14. Why are restriction enzymes important to recombinant DNA? 15. Why are restriction enzymes important to gel electrophoresis? APPLICATIONS OF BIOTECH: 1. stem cell research a. What are embryonic stem cells, where are they found and what are their potential? b. What are somatic stem cells, where are they found and what are their potential? c. What are induced pluripotent stem cells, where are they found and what are their potential? d. What does differentiated cells vs. undifferentiated cells mean? 2. DNA in crime solving a. Explain the process of gel electrophoresis (be sure to include the function of restriction enzymes)
b. What is a DNA fingerprint? c. Explain what is shown below and why suspect two was arrested. 3. In Vitro Fertilization a. Explain the steps of In-vitro Fertilization b. Why would a couple use IVF? 4. sex selection and pre-implantation genetic diagnosis a. Explain what sex-selection is. b. Explain what PGD is. c. How is sex-selection/pgd done? (please look at your notes, many missed this on the quiz). 5. reproductive and therapeutic cloning a. What is formed in reproductive cloning? b. What is formed in therapeutic cloning?
Name: c. What are the steps of reproductive cloning? d. How are the steps different in therapeutic cloning? 6. Genetically modified organisms (crops and animals) a. Define genetically modified organisms b. Explain the steps of creating genetically modified organisms (include the use of restriction enzymes, recombinant DNA, and transformation) c. Explain the example of a transgenic crop from class, Bt corn. d. What are some other examples of GMOS? GENE REGULATION 1. What is gene regulation? 2. Why do organisms regulate their gene expression? 3. One part of gene regulation is to be efficient, what are the 3 steps taken before mrna translation to make the process more efficient? Explain each.
4. What is an operon? 5. Define the following terms: a. Regulatory gene: b. Repressor: c. Operator: d. Promoter: e. Inducer: f. RNA polymerase: 6. Label the image below 7. Is the figure on the previous page showing a gene that is switched on or off? Why 8. In the space below explain the alternate form of the operon for gene expression.
pglo 1. Define transformation 2. In our lab, how do you know if your transformation was successful? 3. Draw the pglo plasmid with the three genes of interest. What is the role of each? 4. Explain how the genes in the plasmid function together to regulate the expression of GFP. You may use drawings and words. 5. What is the purpose of the following things in the lab? - Luria Broth: - Ampicillin: - Arabinose: - Transformation solution: - Heat shock: - -pglo solution: - +pglo solution: - e.coli start plate: 6. On the next page, fill in the chart below 1. On the line in the box next to the agar plate write the correct label of things added to the plate (the order does not matter as long as you have all four.) 2. Inside each agar plate, write whether the bacteria would die, grow, and/or glow. 3. Next to the label, write why you would see each of these outcomes.
1. : 2. : 3. : 4. : 7. What is the difference between arabinose and arac? 8. What is the difference between ampicillin and ampicillin resistance? Which is on the pglo plasmid? What were these two things used?