NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2)

Similar documents
NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1)

NEBNext Fast DNA Fragmentation & Library Prep Set for Ion Torrent

NEBNext Magnesium RNA Fragmentation Module

NEBNext Ultra II Non-Directional RNA Second Strand Synthesis Module

NEBNext. RNA First Strand Synthesis Module LIBRARY PREPARATION. Instruction Manual. NEB #E7525S/L 24/96 reactions Version 4.

NEBNext Multiplex Small RNA Library Prep Set for Illumina Set 1, Set 2, Index Primers 1 48 and Multiplex Compatible

NEBNext Ultra II End Repair/dA-Tailing Module

NEBNext Ultra II Ligation Module

NEBNext DNA Library Prep Master Mix Set for 454

NEBNext Ultra II DNA Library Prep Kit for Illumina

NEBNext rrna Depletion Kit (Human/Mouse/Rat)

NEBNext Quick Ligation Module

NEBNext rrna Depletion Kit (Human/Mouse/Rat)

NEBNext Multiplex Oligos for Illumina (Index Primers Set 2)

NEBNext Multiplex Small RNA Library Prep Kit for Illumina (Index Primers 1-48)

NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1)

NEBNext Ultra Ligation Module

NEBNext End Repair Module

LunaScript RT SuperMix Kit

NEBNext Ultra II End Repair/dA-Tailing Module

NEBNext Quick Ligation Module

NEBNext da-tailing Module

NEBNext Magnesium RNA Fragmentation Module

NEBNext Multiplex Oligos for Illumina (Index Primers Set 3)

ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.

NEBNext Multiplex Oligos for Illumina (Index Primers Set 4)

NEBNext RNase III RNA Fragmentation Module

NEBNext FFPE DNA Repair Mix

3.1 RNA Fragmentation, Priming and First Strand cdna Synthesis. 3.1A RNA Fragmentation and Priming Starting from Intact or Partially Degraded RNA:

NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1)

NEBNext Multiplex Oligos for Illumina (Index Primers Set 1)

II First Strand cdna Synthesis Kit

NEBNext Single Cell/Low Input cdna Synthesis & Amplification Module

NEBNext Single Cell/Low Input cdna Synthesis & Amplification Module

NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina

NEBNext. Ultra II RNA Library Prep Kit for Illumina

AMV First Strand cdna Synthesis Kit

Monarch DNA Gel Extraction Kit

NEBNext Ultra DNA Library Prep Kit for Illumina

OneTaq One-Step RT-PCR Kit

Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep

NEBNext. Multiplex Oligos for Illumina (Dual Index Primers Set 2)

NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs)

NEBNext Small RNA Library Prep Set for SOLiD

NEBNext Multiplex Small RNA Library Prep Set for SOLiD (Set 1)

EnGen Mutation Detection Kit

NEBNext Multiplex Oligos for Illumina (Index Primers Set 3)

AMV LongAmp Taq RT-PCR Kit

NEBNext Ultra RNA Library Prep Kit for Illumina

BIOO LIFE SCIENCE PRODUCTS

NEXTflex Small RNA-Seq Kit v3. (Illumina Compatible) Catalog # (8 reactions) GEL-FREE & LOW INPUT OPTIONS. Bioo Scientific Corp V18.

BIOO LIFE SCIENCE PRODUCTS

Preparing Samples for Analysis of Small RNA

NEBNext Multiplex Oligos for Illumina (Index Primers Set 4)

NEBNext Fast DNA Fragmentation & Library Prep Set for Ion Torrent

NEXTFLEX Rapid Directional RNA-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions)

NEBNext Direct Custom Ready Panels

GENERAL INFORMATION...

EpiMark Bisulfite Conversion Kit

BIOO LIFE SCIENCE PRODUCTS

NEBNext mrna Library Prep Master Mix Set for 454

NEBNext. Multiplex Oligos for Illumina (Dual Index Primers Set 1)

FOR REFERENCE PURPOSES

Preparing Samples for Analysis of Small RNA

TruSeq Small RNA Library Prep Protocol Guide

Hashimshony, Wagner, Sher & Yanai. CEL-Seq: Single cell RNA-Seq by multiplexed linear amplification (Cell Reports).

TailorMix Stranded mrna Sample Preparation Kit

NEBNext Library Quant Kit for Illumina

Q5 Site-Directed Mutagenesis Kit

Fragment Library Preparation

NEBNext. for Ion Torrent LIBRARY PREPARATION KITS

ThruPLEX -FD Prep Kit Instruction Manual. Single Tube Library Preparation for Illumina NGS Platforms

Cleanup. Total Time 2.5 hr

NEXTFLEX ChIP-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V15.

ab High Sensitivity DNA Library Preparation Kit (For Illumina )

ab High Sensitivity DNA Library Preparation Kit (For Illumina )

BIOO LIFE SCIENCE PRODUCTS

NEXTFLEX 16S V4 Amplicon-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V18.

GENERAL INFORMATION...

POLYMERASES & AMPLIFICATION One Taq RT-PCR Kit Instruction Manual NEB #E5310S be INSPIRED 30 reactions drive DISCOVERY Version 2.0 6/18 stay GENUINE

EPIGENTEK. EpiNext DNA Library Preparation Kit (Illumina) Base Catalog # P-1051 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

DNA Ligases and Ligase Master Mixes

EpiMark Methylated DNA Enrichment Kit

Preparing Samples for Analysis of Small RNA Using the Oligo Only Kit

Complete protocol in 110 minutes Enzymatic fragmentation without sonication One-step fragmentation/tagging to save time

HiScribe. T7 ARCA mrna Kit RNA ENZYMES & GENE ANALYSIS. Instruction Manual NEB #S1560S. NEB #E2065S 20 reactions Version /16

Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing

Ion TrueMate Library Preparation

HiScribe. T7 Quick High Yield RNA Synthesis Kit RNA ENZYMES & GENE ANALYSIS. Instruction Manual NEB #S1560S. NEB #E2050S 50 reactions Version 2.

High-Fidelity PCR Kit

EpiNext 5-mC RNA Bisulfite-Seq Easy Kit (Illumina)

Procedure & Checklist - Preparing Asymmetric SMRTbell Templates

BIOO LIFE SCIENCE PRODUCTS. NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) BIOO Scientific Corp V13.01

Multiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms

Preparing Samples for Digital Gene Expression-Tag Profiling with DpnII

HiScribe. T7 ARCA mrna Kit (with tailing) RNA ENZYMES & GENE ANALYSIS. Instruction Manual. NEB #E2060S 20 reactions Version /16 NEB #S1560S

TruSeq ChIP Sample Preparation

NEBNext Microbiome DNA Enrichment Kit

sparq DNA Frag & Library Prep Kit

mrna Library Prep Master Mix Set for Illumina

Transcription:

LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2) Instruction Manual NEB #E7580S/L 24/96 reactions Version 4.0 5/18 be INSPIRED drive DISCOVERY stay GENUINE

This product is intended for research purposes only. This product is not intended to be used for therapeutic or diagnostic purposes in humans or animals. ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered Medical Devices This product is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc. For more information about commercial rights, please email us at gbd@neb.com. While NEB develops and validates its products for various applications, the use of this product may require the buyer to obtain additional third party intellectual property rights for certain applications. Methods for avoidance of adaptor dimer formation are covered by pending patent (New England Biolabs, Inc.). AMPURE is a registered trademark of Beckman Coulter, Inc. AGILENT and BIOANALYZER are registered trademarks of Agilent Technologies, Inc. ILLUMINA is a registered trademark of Illumina, Inc. CORNING, COSTAR and SPIN-X are registered trademarks of Corning, Inc. NOVEX, FIRSTCHOICE and SYBR are registered trademarks of Life Technologies, Inc. FLASHPAGE is a registered trademark of Life Technologies, Inc. PELLET PESTLE is a registered trademark of Kimble Kontes Asset Management, Inc. Copyright 2018, New England Biolabs, Inc; all rights reserved.

NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2) Table of Contents Set 2 Includes...2 Required Materials Not Included...3 Overview...4 Multiplex Small RNA Library Prep Workflow...5 Protocols....6 NEBNext Adaptors and Primers for Illumina...18 Frequently Asked Questions (FAQs)...19 Checklist...21 Kit Components...25 Revision History....27 1

The NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2) Includes: The volumes provided are sufficient for preparation of up to 24 reactions (NEB #E7580S) and 96 reactions (NEB #E7580L). All reagents should be stored at 20 C. (green) NEBNext Ligation Reaction Buffer (2X) (green) NEBNext Ligation Enzyme Mix (green) NEBNext SR Adaptor for Illumina (yellow) NEBNext SR Adaptor for Illumina (yellow) NEBNext Ligation Reaction Buffer (10X) (yellow) NEBNext Ligation Enzyme Mix (pink) NEBNext SR RT Primer for Illumina (red) NEBNext First Strand Synthesis Reaction Buffer (red) ProtoScript II Reverse Transcriptase (red) Murine RNase Inhibitor (blue) LongAmp Taq 2X Master Mix (blue) NEBNext SR Primer for Illumina (blue) NEBNext Index 13 Primer for Illumina (blue) NEBNext Index 14 Primer for Illumina (blue) NEBNext Index 15 Primer for Illumina (blue) NEBNext Index 16 Primer for Illumina (blue) NEBNext Index 17 Primer for Illumina (blue) NEBNext Index 18 Primer for Illumina (blue) NEBNext Index 19 Primer for Illumina (blue) NEBNext Index 20 Primer for Illumina (blue) NEBNext Index 21 Primer for Illumina (blue) NEBNext Index 22 Primer for Illumina (blue) NEBNext Index 23 Primer for Illumina (blue) NEBNext Index 24 Primer for Illumina (orange) Gel Loading Dye, Blue (6X) (orange) Quick-Load pbr322 DNA-MspI Digest (white) DNA Gel Elution Buffer, 1X (white) Linear Acrylamide (10 mg/ml) (white) TE Buffer (white) Nuclease-free Water 2

Required Materials Not Included: 3 M Sodium Acetate, ph 5.5 100% Ethanol 80% Ethanol Monarch PCR & DNA Cleanup Kit (5 µg) (NEB #T1030) Corning, Costar, Spin-X Centrifuge Tube Filters (Cellulose Acetate Filters) (Sigma Aldrich # CLS8162) Size Selection Materials: for gel size selection: 6% Novex TBE PAGE gel 1.0 mm 10-well (Life Technologies, Inc. #EC6265BOX) SYBR Gold Nucleic Acid Gel Stain (Life Technologies, Inc. #S-11494) RNase-free Disposable Pellet Pestles (Kimble Kontes Asset Management, Inc. #749521-1590) Dry Ice/Methanol Bath or 80 C freezer for bead selection: Agencourt AMPure XP Beads (Beckman Coulter, Inc. #A63881) for Pippin Prep selection: 3% Agarose Dye Free Gel (Sage Science #CDP 3010) Bioanalyzer (Agilent Technologies, Inc.) 3

Overview The NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2) contains the adaptors, primers, enzymes and buffers required to convert small RNAs into indexed libraries for next generation sequencing on the Illumina platform. The novel workflow has been optimized to minimized adaptordimers, while producing high-yield, high-diversity libraries. Each kit component must pass rigorous quality control standards, and each set of reagents is functionally validated together by construction and sequencing of indexed small RNA libraries on the Illumina sequencing platform. For larger volume requirements, customized and bulk packaging is available by purchasing through the OEM/Bulks department at NEB. Please contact OEM@ neb.com for further information. RNA Sample Quality: This kit was optimized using high quality human RNA (First Choice Human Brain Reference RNA from Life Technologies, Inc. #AM7962). High Quality total RNA (RNA Integrity Number (RIN) > 7) should be used as starting material whenever possible. The quality and quantity of your sample should be assessed, for example by use of the Agilent 2100 Bioanalyzer, using an Agilent RNA 6000 Nano Chip. 4

Multiplex Small RNA Library Prep Workflow This kit includes a novel protocol that results in higher yields and lower adaptor-dimer contamination. RNA DNA RT Primer App Adaptor Ligation Adaptor Adaptor App App Barcode (BC) P5 Primer P7 Primer Primer Hybridization App App App Adaptor Ligation App First Strand cdna Synthesis PCR Enrichment P5 P5 P5 BC P7 BC P7 BC P7 Clean Up and Size Selection 5

Protocols Please refer to revision history for a summary of protocol updates Symbols SAFE STOP This is a point where you can safely stop the protocol and store the samples prior to proceeding to the next step in the protocol.! This caution sign signifies a step in the protocol that has two paths leading to the same end point but is dependent on a user variable, like the type of RNA input. Colored bullets indicate the cap color of the reagent to be added Libraries prepared by this method are compatible with Illumina paired-end flow cells. Starting Material: 100 ng 1 µg Total RNA. Small RNA fragments should have a phosphate and OH to ligate and must be free of ATP. 1. Ligate the SR Adaptor Note: For total RNA inputs closer to 100 ng, dilute the (green) SR Adaptor for Illumina 1:2 (For example: 1 µl of SR adaptor and 1 µl nuclease-free water) in nuclease-free water. For total RNA inputs closer to 1 µg, do not further dilute the adaptor. Adaptor dilutions may need to be optimized further. 1.1. Mix the following components in a sterile nuclease-free PCR tube. It is ok to premix the reagents. Use immediately. Input RNA 1 6 µl (green) SR Adaptor for Illumina 1 µl Nuclease-Free Water variable Total volume 7 µl 6 1.2. Incubate in a preheated thermal cycler for 2 minutes at 70 C. Transfer tube to ice. 1.3. Add and mix the following components. It is ok to premix the reagents. Use immediately. (green) Ligation Reaction Buffer (2X) 10 µl (green) Ligation Enzyme Mix 3 µl Total volume 20 µl 1.4. Incubate for 1 hour at 25 C in a thermal cycler. Note: Longer incubation times and reduced temperatures (18 hours; 16 C) increase ligation efficiency of methylated RNAs such as piwiinteracting RNAs (pirnas) (if present in the sample). However, some concatamerization products might be formed.

2. Hybridize the Reverse Transcription Primer This step is important to prevent adaptor-dimer formation. The SR RT Primer hybridizes to the excess of SR Adaptor (that remains free after the ligation reaction) and transforms the single stranded DNA adaptor into a double-stranded DNA molecule. dsdnas are not substrates for ligation mediated by T4 RNA Ligase 1 and therefore do not ligate to the SR Adaptor in the subsequent ligation step. Note: For total RNA inputs closer to 100 ng, dilute the (pink) SR RT Primer for Illumina 1:2 in nuclease free water. For total RNA inputs closer to 1 µg do not dilute the primer. Depending on the small RNA quantity and quality of your sample additional dilution optimization may be required. 2.1. Add and mix the following components to the ligation mixture from Step 1.4 and mix well. It is ok to premix the reagents. Nuclease-Free Water 4.5 µl (pink) SR RT Primer for Illumina 1 µl Total volume now should be 25.5 µl 2.2. Place in a thermocycler with heated lid set to > 85 C and run the following program: 5 minutes at 75 C 15 minutes at 37 C 15 minutes at 25 C Hold at 4 C 3. Ligate the SR Adaptor 3.1. With 5 minutes remaining, resuspend the (yellow) SR adaptor in 120 µl of nuclease free water. Note: For total RNA inputs closer to 100 ng, additionally dilute the (yellow) SR Adaptor for Illumina 1:2 in nuclease free water. For total RNA inputs closer to 1 µg do not dilute the adaptor further. 3.2. Aliquot the (yellow) SR Adaptor into a separate, nuclease-free 200 µl PCR tube, for the number of samples in the experiment plus an excess of 10%. 3.3. Incubate the adaptor in the thermal cycler at 70 C for 2 minutes and then immediately place the tube on ice. Keep the tube on ice and use the denatured adaptor within 30 minutes of denaturation. Note: Store the remaining resuspended SR adaptor at 80 C. Denature aliquots before use. Please minimize freeze/thaw cycles. If only a few libraries are to be made at a time, the SR adaptor should be aliquoted. 7

3.4. Add and mix the following components to the ligation mixture from Step 2.2 and mix well. Do not premix reagents. (yellow) SR Adaptor for Illumina (denatured) 1 µl (yellow) Ligation Reaction Buffer (10X) 1 µl (yellow) Ligation Enzyme Mix 2.5 µl Total volume 30 µl 3.5. Incubate for 1 hour at 25 C in a thermal cycler. 4. Perform Reverse Transcription 4.1. Mix the following components in a sterile, nuclease-free tube. It is ok to premix the reagents. Use immediately. Adaptor Ligated RNA from Step 3.5 30 µl (red) First Strand Synthesis Reaction Buffer 8 µl (red) Murine RNase Inhibitor 1 µl (red) ProtoScript II Reverse Transcriptase 1 µl Total volume 40 µl 4.2. Incubate for 60 minutes at 50 C. 4.3. Immediately proceed to PCR amplification. SAFE STOP Safe Stopping Point: If you do not plan to proceed immediately to PCR amplification, then heat inactivate the RT reaction at 70 C for 15 minutes. Samples can be safely stored at 15 C to 25 C. 5. Perform PCR Amplification 5.1. Add and mix the following components to the RT reaction mix from Step 4.2 and mix well: (blue) LongAmp Taq 2X Master Mix 50 µl (blue) SR Primer for Illumina 2.5 µl (blue) Index (X) Primer* 2.5 µl Nuclease free water 5 µl Total volume now should be 100 µl *Note: The NEBNext Multiplex Small RNA Library Prep Set for Illumina Set 2 contains 13 24 PCR primers, each with a different index. For each reaction, only one of the 12 PCR primer indices is used during the PCR step. 8

PCR Cycling conditions: CYCLE STEP TEMP TIME CYCLES Initial Denaturation 94 C 30 sec 1 Denaturation Annealing Extension 94 C 62 C 70 C 15 sec 30 sec 15 sec Final Extension 70 C 5 min 1 Hold 4 C 12 15* * Amplification conditions may vary based on RNA input amount, tissue, and species. This protocol was optimized using 1 µg of total RNA from human brain and 12 PCR cycles. The number of PCR cycles may need to be adjusted if clear and distinct bands are not observed in the gel image. For 100 ng total RNA input run 15 cycles of PCR. For samples containing high amounts of small RNA less than 12 cycles may be appropriate. SAFE STOP Safe Stopping Point: It is safe to store the library at -20 C after PCR. Avoid leaving the sample at 4 C overnight if possible. 9

6. Quality Control Check and Size Selection Note: There are several different methods for performing size selection. It is recommended to choose the appropriate method based on the QC check of the library using the Bioanalyzer. Size selection using AMPure XP Beads does not remove small fragments. If you perform the QC check and your sample contains Adaptor dimer (127 bp peak) or excess primers (70-80 bp) it is recommended to use gel or Pippin Prep for size selection. 6A. QC Check and Size Selection using 6% PolyAcrylamide Gel 6A.1. 6A.2. Purify the PCR amplified cdna construct (100 µl) using a Monarch PCR & DNA Kit. IMPORTANT: Use the 7:1 ratio of binding buffer:sample. Discard the flow through after each centrifugation step. Elute amplified DNA in 27.5 µl Nuclease-free Water. SAFE STOP Safe Stopping Point: It is safe to store the library at -20 C. 10

6A.3. Load 1 µl of the purified PCR reaction on the Bioanalyzer using a DNA 1000 chip according to the manufacturer's instructions (Figure 1). Figure 1: Typical results from (A) human brain and (B) rat testis total RNA libraries before size selection. A. [FU] 70 60 143 1500 50 40 30 20 15 153 191 165 207 271 10 0-10 15 100 200 300 400 700 1,500 [nt] B. [FU] 120 153 100 80 60 1500 40 20 15 186 273 0 15 100 300 500 1,500 [nt] The 143 and 153 bp bands correspond to mirnas and pirnas, respectively. The bands on the Bionalyzer electropherograms resolve in sizes ~ 6-8 nucleotides larger than sizes observed on PAGE gels and can shift from sample to sample due to an incorrect identification of the marker by the bioanalyzer software. mirna peak should be ~ 143-146 bp. 6A.4. 6A.5. 6A.6. 6A.7. Mix the purified PCR product (25 µl) with 5 µl of Gel Loading Dye, Blue (6X). Note: Vortex the Gel Loading Dye, Blue throughly to mix well before using. Load 5 µl of Quick-Load pbr322 DNA-MspI Digest in one well on the 6% PAGE 10-well gel. Load two wells with 15 µl each of mixed amplified cdna construct and loading dye on the 6% PAGE 10-well gel. Run the gel for 1 hour at 120 V or until the blue dye reaches the bottom of the gel. Do not let the blue dye exit the gel. 11

6A.8. Remove the gel from the apparatus and stain the gel with SYBR Gold nucleic acid gel stain in a clean container for 2 3 minutes and view the gel on a UV transiluminator (Figure 2). Figure 2: A. bp Molecular Marker Human Brain B. bp Molecular Marker Rat Testis 622 622 527 527 404 404 307 307 242 217 190 160 147 123 110 90 mirna (~140 bp) 242 217 190 160 147 123 110 90 76 67 pirna (~150 bp) 76 67 Shows typical results from Human Brain (A) and Rat Testis (B) Total RNA libraries. The 140 and 150 bp bands correspond to mirnas (21 nt) and pirnas (30 nt), respectively. 6A.9. The 140 and 150 nucleotide bands correspond to adapter-ligated constructs derived from the 21 and 30 nucleotide RNA fragments, respectively. For mirnas, isolate the bands corresponding to ~140 bp. For pirnas, isolate the band corresponding to ~150 bp. For other small RNA the band size may be different. 12 6A.10. Place the two gel slices from the same sample in one 1.5 ml tube and crush the gel slices with the RNase-free Disposable Pellet Pestles and then soak in 250 µl DNA Gel Elution buffer (1X). 6A.11. Rotate end-to-end for at least 2 hours at room temperature. 6A.12. Transfer the eluate and the gel debris to the top of a gel filtration column. 6A.13. Centrifuge the filter for 2 min at > 13,200 rpm. 6A.14. Recover eluate and add 1 µl Linear Acrylamide, 25 µl 3M sodium acetate, ph 5.5 and 750 µl of 100% ethanol.

6A.15. Vortex well. 6A.16. Precipitate in a dry ice/methanol bath or at 80 C for at least 30 minutes. 6A.17. Spin in a microcentrifuge @ > 14,000 x g for 30 minutes at 4 C. 6A.18. Remove the supernatant taking care not to disturb the pellet. 6A.19. Wash the pellet with 80% ethanol by vortexing vigorously. 6A.20. Spin in a microcentrifuge @ > 14,000 x g for 30 minutes at 4 C. 6A.21. Air dry pellet for up to 10 minutes at room temperature to remove residual ethanol. 6A.22. Resuspend pellet in 12 µl TE Buffer. 6A.23. Load 1 µl of the size selected purified library on a 2100 Bioanalyzer using a DNA 1000 or High Sensitivity DNA chip according to the manufacturer's instructions (Figure 3). 6A.24. Check the size, purity, and concentration of the sample. Figure 3: Electropherogram trace of the gel size selected purified library from human brain total RNA. [FU] 1,000 147 500 0 35 10,380 12,634 40 50 60 70 80 90 100 110 120 130 [s] 13

6B. QC Check and Size Selection Using Pippin Prep Size selection of the Small RNA library (147 bp) can done on Pippin Prep instrument using the 3% Agarose, dye free gel with internal standards (Sage Science # CDP3010). 6B.1. 6B.2. Purify the PCR amplified cdna construct (100 µl) using a Monarch PCR & DNA Cleanup Kit. IMPORTANT: Use the 7:1 ratio of binding buffer:sample. Discard the flow through after each centrifugation step. Elute amplified DNA in 32 μl nuclease-free water. SAFE STOP Safe Stopping Point: It is safe to store the library at -20 C after 6B.3. PCR cleanup. It is recommended to QC your library before performing size selection: Load 1 μl of the purified PCR reaction on the Bioanalyzer using a DNA 1000 chip according to the manufacturer's instructions (Figure 1).. mirna library should appear as a peak at 147 bp peak (that correspond for 21 nucleotide insert). 6B.4. 6B.5. 6B.6. 6B.7. 6B.8. 6B.9. Program the protocol for size selection on Pippin Prep Instrument as follows: In the Pippin Prep software, go to the Protocol Editor Tab. Click Cassette folder, and select 3% DF Marker P. Select the collection mode as Range and enter the size selection parameters as follow: BP start (105) and the BP end (155). BP Range Flag should indicate broad. Note: This protocol is optimized to select for 147 149 bp peak. When targeting other small RNA these settings may have to be adjusted. Click the Use of Internal Standards button. Make sure the Ref Lane values match the lane numbers. Press Save As and name and save the protocol. Prepare sample for size selection as follows: 6B.10. Bring loading solution to room temperature 6B.11. For each sample, combine 30 µl sample with 10 µl of DNA marker P (labeled P). 6B.12. Mix samples thoroughly (vortex mixer). Briefly centrifuge to collect. 6B.13. Load 40 µl (DNA plus marker) on one well of the 3% agarose cassette. 6B.14. Run the program with the settings indicated above. 14

6B.15. After sample has been eluted, collect 40 µl sample from elution well. Run 1 µl in a Bioanalzyer using the high sensitivity chip. Note: If the Ethidium Bromide free cassettes was used, no purification is required before running sample on the bioanalyzer. Figure 4: Electropherogram trace of Pippin Prep size selected library from human brain total RNA. 15

6C. QC Check and Size Selection using AMPure XP Beads Note: Bead size selection is only recommended for samples showing no primer dimer and no adaptor dimer on Bioanalyzer. It will be suitable to remove peaks > 150 bp. If fragments larger than 150 bp are abundant, two rounds of bead size selection may be necessary to completely eliminate the high molecular weight fragments. 6C.1. 6C.2. Purify the PCR amplified cdna construct (100 µl) using a Monarch PCR & DNA Kit. IMPORTANT: Use the 7:1 ration of binding buffer:sample. Discard the flow through after each centrifugation step. Elute amplified DNA in 27.5 µl Nuclease-free Water. SAFE STOP Safe Stopping Point: It is safe to store the library at -20 C after 6C.3. 6C.4. 6C.5. 6C.6. 6C.7. 6C.8. 6C.9. PCR cleanup. Load 1 µl of the purified PCR reaction on the Bioanalyzer using a DNA 1000 chip according to the manufacturer's instructions (Figure 1). To the purified PCR reaction (25 µl), add 32.5 μl (1.3X) of resuspended AMPure XP beads and mix well on a vortex mixer or by pipetting up and down at least 10 times. Incubate for 5 minutes at room temperature. Place the tube on an appropriate magnetic stand to separate beads from supernatant. After the solution is clear (about 5 minutes), carefully transfer the supernatant (57.5 µl) to a new tube (Caution: do not discard the supernatant). Discard beads that contain the large DNA fragments. Add 92.5 μl (3.7X) of resuspended AMPure XP beads to the supernatant (57.5 μl), mix well and incubate for 5 minutes at room temperature. Place the tube on an appropriate magnetic stand to separate beads from supernatant. After the solution is clear (about 5 minutes), carefully remove and discard the supernatant. Be careful not to disturb the beads that contain DNA targets (Caution: do not discard beads). Add 200 μl of freshly prepared 80% ethanol to the tube while in the magnetic stand. Incubate at room temperature for 30 seconds, and then carefully remove and discard the supernatant. 6C.10. Repeat Step 6C.9 once. 16

6C.11. Briefly spin the tube, and put the tube back in the magnetic stand. 6C.12. Completely remove the residual ethanol, and air dry beads for up to 10 minutes while the tube is on the magnetic stand with lid open. Caution: Do not overdry the beads, which may result in lower recovery of the DNA target. Elute the sample when the beads are still dark brown and glossy looking, but when all visible liquid has evaporated. When the beads turn lighter brown and start to crack they are too dry. 6C.13. Elute the DNA target from the beads with 15 μl nuclease-free water. Mix well on a vortex mixer or by pipetting up and down, incubate for 2 minutes and put the tube in the magnetic stand until the solution is clear. 6C.14. Transfer the supernatant to a clean PCR tube. 6C.15. Run 1 µl on the Bioanalyzer High Sensitivity chip. Check peak distribution and concentration of the small RNA library. Figure 5: Electropherogram trace of the bead size selected purified library from human brain total RNA. 17

NEBNext Adaptors and Primers for Illumina PRODUCT NEBNext Index 13 Primer for Illumina NEBNext Index 14 Primer for Illumina NEBNext Index 15 Primer for Illumina NEBNext Index 16 Primer for Illumina NEBNext Index 17 Primer for Illumina NEBNext Index 18 Primer for Illumina NEBNext Index 19 Primer for Illumina NEBNext Index 20 Primer for Illumina NEBNext Index 21 Primer for Illumina NEBNext Index 22 Primer for Illumina NEBNext Index 23 Primer for Illumina NEBNext Index 24 Primer for Illumina INDEX PRIMER SEQUENCE -CAAGCAGAAGACGGCATACGAGATTTGACTGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATGGAACTGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATTGACATGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATGGACGGGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATCTCTACGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATGCGGACGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATTTTCACGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATGGCCACGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATCGAAACGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATCGTACGGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATCCACTCGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- -CAAGCAGAAGACGGCATACGAGATGCTACCGT GACTGGAGTTCAGACGTGTGCTCTTCCGATC*T- EXPECTED INDEX PRIMER SEQUENCE READ AGTCAA AGTTCC ATGTCA CCGTCC GTAGAG GTCCGC GTGAAA GTGGCC GTTTCG CGTACG GAGTGG GGTAGC NEBNext SR Adaptor for Illumina -rappagatcggaagagcacacgtct-nh 2 - N/A NEBNext SR Adaptor for Illumina -rgrururcrargrargrururcrurarcrargrurcrcr GrArCrGrArUrC- N/A Where -*- indicates phosphorothioate bond. Note: If fewer than 12 indexes are used in a lane for sequencing, it is recommended to use the following combinations: Pool of 3 Samples: Index# 13, 18 and 23 Pool of 4 Samples: Index# 13, 14, 16 and 18 18

Frequently Asked Questions (FAQs) Q: How should my NEBNext Small RNA Library be trimmed? A. Use the following: Single Ends Reads (Read 1): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Paired End Reads (Read 2): GATCGTCGGACTGTAGAACTCTGAAC Q: Can I use Total RNA to make small RNA libraries or do I have to isolate or enrich the sample for small RNA? A. Small RNA libraries can be done using Total RNA. It is not necessary to enrich the sample for small RNA if small RNA species are in a concentration higher than 0.5%. Total RNA with a RIN (RNA Integrity Number) higher than 7 is recommended. Q: Why does the RT primer hybridization occur before adaptor ligation? A. The small RNA library prep protocol has been improved to prevent adaptordimer formation. The RT primer is added to anneal with the un-ligated adaptor and transform a single-stranded DNA adaptor in to a double-stranded DNA molecule that is no longer a substrate for T4 RNA ligase 1. Q: Do I have to hybridize the RT primer again after ligation? A. No, RT primer hybridization occurs before the adaptor ligation. After the ligation reaction, keep the sample on ice and do not heat the sample to avoid denaturation of the RT annealed primer. Q: How are the barcodes introduced in the Multiplex libraries? A. A six-base indices are introduced during the PCR step. This design allows for the indexes to be read using a second read and significantly reduces bias compared to designs which include the index within the first read. Q: During size selection on 6% PAGE gel, which bands should I cut out of the gel? A. The 140 and 150 bp bands correspond to adaptor-ligated constructs derived from the 21 and 30 nucleotide RNA fragments, respectively. The mirna libraries run at 140 bp corresponding to 21 nucleotides and pirna libraries run at 150 bp corresponding to 30 nucleotides. Q: Are libraries prepared by this method compatible with paired-end flowcells for cluster generation? A. Yes, libraries prepared by this method can be loaded on paired-end flowcells. 19

Frequently Asked Questions (FAQs) (continued) Q: Can I use the small RNA sample preparation kit for Directional- RNA sequencing? A. Yes, the Multiplex small RNA library preparation kit can be used for Directional RNA-Seq. For this application use purified and fragmented messenger RNA as input. Depending on the amount of mrna used as input, dilution of the adaptors and reverse transcription primer and PCR primers might be required. Q: What should I do if my small RNA may not have phosphate and OH groups? A. Please contact NEB Techsupport for an end repair protocol using T4 PNK. Q: Can I use enriched small RNA instead of total RNA for the NEBNext Small RNA Library Prep for Illumina? A. Yes, enriched small RNA can be used. If using closer to 10 ng of enriched small RNA, follow the adaptor dilution recommendadtions for 100 ng total RNA. If using closer to 100 ng enriched small RNA, follow the adaptor dilution recommendations for 1 µg of total RNA. 20

Checklist: 1. Ligate the SR Adaptor [ _ ] 1.0. Adaptor Dilution if < 100 ng total RNA input 1:2 [ _ ] 1.1. Add Reagents to 1-6 µl sample: [ _ ] 1 µl SR Adaptor [ _ ] X µl Nuclease-free water [ _ ] 1.2. Mix and incubate at 70 C for 2 min. Transfer to ice. [ _ ] 1.3. Add Reagents [ _ ] 10 µl Ligation Reaction Buffer (2X) [ _ ] 3 µl Ligation Enzyme Mix [ _ ] 1.4. Mix and incubate at 25 C for 1 hour 2. Hybridize the Reverse Transcription Primer [ _ ] 2.0. Dilute adaptor if necessary [ _ ] 2.1. Add reagents to sample: [ _ ] 4.5 µl water [ _ ] 1 µl SR RT Primer [ _ ] 2.2. Mix and incubate 75 C for 5 min, 37 C for 15 min, 25 C for 15 min. 3. Ligate the SR Adaptor [ _ ] 3.1. Resuspend SR adaptor in 120 µl nuclease free water; dilute? [ _ ] 3.2. Aliquot. [ _ ] 3.3. Denature one aliquot 70 C for 2 min., then immediately put on ice [ _ ] 3.4. Add Reagents to Sample [ _ ] 1 µl SR adaptor [ _ ] 1 µl Ligation Reaction Buffer (10X) [ _ ] 2.5 µl Ligation Enzyme [ _ ] 3.5. Mix and incubate at 25 C for 1hr. 21

22 4. Perform Reverse Transcription [ _ ] 4.1. Add Reagents to Sample [ _ ] 8 µl First Strand Synthesis Reaction Buffer [ _ ] 1 µl Murine RNase Inhibitor [ _ ] 1 µl ProtoScript II Reverse Transcriptase [ _ ] 4.2. Mix and incubate at 50 C for 1 hour. [ _ ] 4.3. Immediately proceed to PCR or heat inactivate at 70 C for 15 min 5. Perform PCR Amplification [ _ ] 5.1. Add Reagents to Sample [ _ ] 50 µl LongAmp Taq 2X Master Mix [ _ ] 2.5 µl SR primer for Illumina [ _ ] 2.5 µl Index Primer [ _ ] 5 µl Nuclease-free water [ _ ] 5.2. Mix and thermal cycle (94 C 30 Sec, 12-15 cycles of 94 C 15 sec, 62 C 30 sec, 70 C 15 sec; 70 C for 5 min, 4 C hold) 6. Quality Control Check and Size Selection 6A. QC Check and Size Selection using 6% Poly Acrylamide Gel [ _ ] 6A.1 Purify the PCR using Monarch PCR & DNA Cleanup Kit. [ _ ] 6A.2 Elute in 27.5 µl Nuclease-free Water [ _ ] 6A.3 Load 1 µl on a Bioanalyzer DNA 1000 Chip [ _ ] 6A.4 Vortex Gel Loading Dye well and mix 25 µl PCR product with 5 µl Gel Loading Dye [ _ ] 6A.5 Load 5 µl Quick-Load pbr322 DNA-MspI on one well [ _ ] 6A.6 Load two wells with each sample [ _ ] 6A.7 Run 1 hour 120V [ _ ] 6A.8 Stain with SYBR Gold 2-3 min and view [ _ ] 6A.9 Cut out appropriate bands [ _ ] 6A.10 Place gel in 1.5 ml tubes and soak in 250 µl gel elution buffer [ _ ] 6A.11 Rotate for at least 2 hours at RT

[ _ ] 6A.12 Transfer eluate and gel to filter column [ _ ] 6A.13. Spin 2 min > 13,200 rpm [ _ ] 6A.14. Recover eluate, add [ _ ] 1 µl linear acrylamide [ _ ] 25 µl 3 M Sodium Acetate ph 5.5 [ _ ] 750 µl 100% ethanol [ _ ] 6A.15. Vortex [ _ ] 6A.16. Precipitate for > 30 min [ _ ] 6A.17. Spin > 14,000 x g for 30 min at 4 C [ _ ] 6A.18. Remove supernatant [ _ ] 6A.19. Add 80% ethanol and vortex [ _ ] 6A.20. Spin > 14,000 x g for 30 min at 4 C [ _ ] 6A.21. Air dry pellet 10 min [ _ ] 6A.22. Resuspend pellet in 12 µl TE buffer [ _ ] 6A.23. Load 1 µl on Bioanalyzer [ _ ] 6A.24. Check size, concentration and purity 6B. QC Check and Size Selection Using Pippin Prep [ _ ] 6B.1. Purify the PCR using Monarch PCR and DNA Cleanup Kit [ _ ] 6B.2. Elute in 32 µl Nuclease-free Water [ _ ] 6B.3. Load 1 µl on a Bioanalyzer DNA 1000 Chip [ _ ] 6B.4. Go to protocol editor tab [ _ ] 6B.5. Click cassette folder and select 3% DF marker P [ _ ] 6B.6. Select collection mode as Range ; BP Start (105) and BP End (155), range flag broad [ _ ] 6B.7. Use internal standards [ _ ] 6B.8. Check ref lane values match lane numbers [ _ ] 6B.9. Save protocol [ _ ] 6B.10. Warm loading solution to RT [ _ ] 6B.11. Combine 30 µl sample and 10 µl DNA Marker P 23

[ _ ] 6B.12. Vortex and quick spin [ _ ] 6B.13. Load 40 µl sample in agarose cassette [ _ ] 6B.14. Run program [ _ ] 6B.15. Collect sample from elution well and load 1 µl on Bioanalyzer High Sensitivity Chip 6C. QC Check and Size Selection using AMPure XP or SPRIselect Beads [ _ ] 6C.1. Purify the PCR using Monarch PCR & DNA Cleanup Kit [ _ ] 6C.2. Elute in 27.5 µl Nuclease-free Water [ _ ] 6C.3. Load 1 µl on a Bioanalyzer DNA 1000 Chip [ _ ] 6C.4. Add 32.5 µl of beads to 25 µl sample and mix by pipetting 10 times [ _ ] 6C.5. Incubate 5 min [ _ ] 6C.6. Place tubes on magnet, separate, and transfer supernatant to a new tube (keep supernatant!) [ _ ] 6C.7. Add 92.5 µl of beads to the supernatant and mix by pipetting 10 times. Incubate 5 min [ _ ] 6C.8. Place tubes on magnet. Wait 5 min then remove the supernatant (keep the beads) [ _ ] 6C.9. On magnet add 200 µl 80% ethanol, wait 30 seconds and remove [ _ ] 6C.10. Repeat Step 6C.9. once [ _ ] 6C.11. Briefly spin tube and return to magnet [ _ ] 6C.12. Remove residual ethanol, air dry beads, do not overdry [ _ ] 6C.13. Off magnet add 15 µl Nuclease-free Water; mix by pipetting 10 times. Incubate 2 min; place tubes on magnet. Wait 5 min [ _ ] 6C.14. Transfer supernatant to a new tube [ _ ] 6C.15. Run 1 µl on a Bioanalyzer High Sensitivity Chip 24

Kit Components NEB #E7580S, Table of Components NEB # PRODUCT VOLUME E7301A NEBNext Ligation Reaction Buffer (2X) 0.24 ml E7288A NEBNext Ligation Enzyme Mix 0.072 ml E7332A NEBNext SR Adaptor for Illumina 0.024 ml E7328A NEBNext SR Adaptor for Illumina 1350 pmol E7304A NEBNext Ligation Reaction Buffer (10X) 0.024 ml E7305A NEBNext Ligation Enzyme Mix 0.06 ml E7333A NEBNext SR RT Primer for Illumina 0.024 ml E7334A NEBNext First Strand Synthesis Reaction Buffer 0.192 ml E7355A ProtoScript II Reverse Transcriptase 0.024 ml E7308A Murine RNase Inhibitor 0.024 ml E7309A LongAmp Taq 2X Master Mix 1.2 ml E7310A NEBNext SR Primer for Illumina 0.060 ml E6138A Gel Loading Dye, Blue (6X) 0.2 ml E7323A Quick-Load pbr322 DNA-MspI Digest 0.24 ml E7324A DNA Gel Elution Buffer, 1X 12 ml E7325A Linear Acrylamide (10 mg/ml) 0.048 ml E7326A TE Buffer 0.48 ml E7327A Nuclease-free Water 5.0 ml E7581A NEBNext Index 13 Primer for Illumina 0.010 ml E7582A NEBNext Index 14 Primer for Illumina 0.010 ml E7583A NEBNext Index 15 Primer for Illumina 0.010 ml E7584A NEBNext Index 16 Primer for Illumina 0.010 ml E7585A NEBNext Index 17 Primer for Illumina 0.010 ml E7586A NEBNext Index 18 Primer for Illumina 0.010 ml E7587A NEBNext Index 19 Primer for Illumina 0.010 ml E7588A NEBNext Index 20 Primer for Illumina 0.010 ml E7589A NEBNext Index 21 Primer for Illumina 0.010 ml E7590A NEBNext Index 22 Primer for Illumina 0.010 ml E7591A NEBNext Index 23 Primer for Illumina 0.010 ml E7592A NEBNext Index 24 Primer for Illumina 0.010 ml 25

Kit Components NEB #E7580L, Table of Components NEB # PRODUCT VOLUME E7301AA NEBNext Ligation Reaction Buffer (2X) 0.96 ml E7288AA NEBNext Ligation Enzyme Mix 0.288 ml E7332AA NEBNext SR Adaptor for Illumina 0.096 ml E7328A NEBNext SR Adaptor for Illumina 1350 pmol E7304AA NEBNext Ligation Reaction Buffer (10X) 0.096 ml E7305AA NEBNext Ligation Enzyme Mix 0.24 ml E7333AA NEBNext SR RT Primer for Illumina 0.096 ml E7334AA NEBNext First Strand Synthesis Reaction Buffer 0.768 ml E7355AA ProtoScript II Reverse Transcriptase 0.096 ml E7308AA Murine RNase Inhibitor 0.096 ml E7309AA LongAmp Taq 2X Master Mix 4.8 ml E7310AA NEBNext SR Primer for Illumina 0.240 ml E6138AA Gel Loading Dye, Blue (6X) 1 ml E7323AA Quick-Load pbr322 DNA-MspI Digest 0.96 ml E7324AA DNA Gel Elution Buffer, 1X 48 ml E7325AA Linear Acrylamide (10 mg/ml) 0.192 ml E7326AA TE Buffer 1.92 ml E7327AA Nuclease-free Water 20.0 ml E7581AA NEBNext Index 13 Primer for Illumina 0.040 ml E7582AA NEBNext Index 14 Primer for Illumina 0.040 ml E7583AA NEBNext Index 15 Primer for Illumina 0.040 ml E7584AA NEBNext Index 16 Primer for Illumina 0.040 ml E7585AA NEBNext Index 17 Primer for Illumina 0.040 ml E7586AA NEBNext Index 18 Primer for Illumina 0.040 ml E7587AA NEBNext Index 19 Primer for Illumina 0.040 ml E7588AA NEBNext Index 20 Primer for Illumina 0.040 ml E7589AA NEBNext Index 21 Primer for Illumina 0.040 ml E7590AA NEBNext Index 22 Primer for Illumina 0.040 ml E7591AA NEBNext Index 23 Primer for Illumina 0.040 ml E7592AA NEBNext Index 24 Primer for Illumina 0.040 ml 26

Revision History REVISION # DESCRIPTION DATE 1.0 New Document 1.1 Updated marker settings for size selection using the Pippin Prep. Marker F is replacing Marker M. 2.0 Change catalog number for NEBNext Ligation Enzyme Mix to NEB #E7288. 3.0 Workflow diagram added. Protocol new numbering applied and text edits applied. New Checklist and FAQs applied. Note added to NEBNext Index 13-24 Primers for Illumina. In Step 2.2 added heated lid temperature. Added where it is ok to premix reagents. Added Safe Stop after PCR and after PCR cleanup. Clarification of when ok to use AMPure XP Size Selection. Changed Pippen Prep Cassette Type and Marker to newly released product. Replaced Qiagen Cleanup kit with Monarch Cleanup Kit 4.0 Change Index Primer sequences table to include adaptors and rename it as NEBNext Adaptors and Primers for Illumina. Create "Kit Component Table of Components" for small and large size kits. Delete individual component information pages. 9/17 5/18 27

DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION & ANALYSIS CELLULAR ANALYSIS USA New England Biolabs, Inc. 240 County Road Ipswich, MA 01938-2723 Telephone: (978) 927-5054 Toll Free: (USA Orders) 1-800-632-5227 Toll Free: (USA Tech) 1-800-632-7799 Fax: (978) 921-1350 e-mail: info@neb.com www.neb.com CANADA New England Biolabs, Ltd. Telephone: (905) 665-4632 Toll Free: 1-800-387-1095 Fax: (905) 665-4635 Fax Toll Free: 1-800-563-3789 e-mail: info.ca@neb.com www.neb.ca CHINA New England Biolabs (Beijing), Ltd. Telephone: 010-82378265/82378266 Fax: 010-82378262 e-mail: info@neb-china.com www.neb-china.com FRANCE New England Biolabs France Free Call: 0800-100-632 Free Fax: 0800-100-610 e-mail: info.fr@neb.com www.neb-online.fr GERMANY & AUSTRIA New England Biolabs GmbH Telephone: +49/(0)69/305 23140 Free Call: 0800/246 5227 (Germany) Free Call: 00800/246 52277 (Austria) Fax: +49/(0)69/305 23149 Free Fax: 0800/246 5229 (Germany) e-mail: info.de@neb.com www.neb-online.de JAPAN New England Biolabs Japan, Inc. Telephone: +81 (0)3 5669 6191 Fax: +81 (0)3 5669 6192 e-mail: info.jp@neb.com www.nebj.jp SINGAPORE New England Biolabs Pte. Ltd. Telephone: +65 638 59623 Fax: +65 638 59617 e-mail: sales.sg@neb.com www.neb.sg UNITED KINGDOM New England Biolabs (UK) Ltd. Telephone: (01462) 420616 Call Free: 0800 318486 Fax: (01462) 421057 Fax Free: 0800 435682 e-mail: info.uk@neb.com www.neb.uk.com