Supplemental Material for The Activity of Glycopeptide Antibiotics Against Resistant Bacteria Correlates with their Ability to Induce the Resistance System Min Jung Kwun, Hee-Jeon Hong# Department of Biochemistry, University of Cambridge, Cambridge, United Kingdom Running Title: Structure-Activity Study of Glycopeptide Derivatives #Address correspondence to Hee-Jeon Hong, hh309@cam.ac.uk. 1
EXPERIMENTAL SECTIONS Antibiotics, bacterial strains, growth conditions, and MIC determination All chemo-enzymatically synthesized glycopeptide derivatives used for this study were kindly provided by Daniel Kahne and his coworkers. Except where described here, media and culture conditions were as given previously (1). For the MIC test, vancomycin-resistant S. coelicolor wild type (M600) and vancomycin-sensitive S. coelicolor ΔvanRS (J3201) were used (2). Approximately 10 5 spores of each S. coelicolor strain were germinated by heat shock treatment in 5 ml of TES buffer (0.05 M, ph8) at 50 C for 10 min, then diluted with an equal volume of germination medium (1% (w/v) Difco yeast extract, 1% (w/v) Difco casamino acids, 0.01 M CaCl 2 ) and incubated with shaking at 37 C for 2-3 h. The culture broth was centrifuged for 1 min at 4,000 g, and the pellet was resuspended in 1 ml of NMMP liquid medium. 10 μl of germinated spores were then inoculated in 140 μl of NMMP liquid medium containing the antibiotic under test at a range of concentrations in 96-well plates. After overnight shaking incubation at 30 C, MIC values were determined by visual inspection of growth over the range of antibiotic concentrations. RNA preparation and quantitative real time PCR (qrt-pcr) RNA preparation and qrt-pcr were performed according to method described previously (3, 4). For RNA preparation, 0.5 ml of germinated spores of S. coelicolor M600 in NMMP as described above were inoculated in 25 ml NMMP liquid medium and grown to mid-log phase (~0.5 at OD 600 ). 5 ml of the first sample was taken as non-induced control (0 min). Immediately after the first sample was taken, final concentration of 10 μg/ml antibiotic was added to the culture broth and samples were taken in 30 min time intervals up to 90 min (30 min, 60 min, 90 min). As soon as the 5 ml of sample broth was taken, the sample was centrifuged for 10 s at 4,000 g and the prepared cell pellet was resuspended into 10 ml of RNA protect bacteria solution (Qiagen). After 5 min incubation at room temperature, the sample was centrifuged again for 10 s at 4,000 g and the supernatant was discarded. The obtained pellet can be store for up to 1 month at -80 C until for use. For RNA preparation, cell pellet was resuspended in 1 ml of ice-cold Kirby mix and sonicated twice for 4-5 s each, then extracted with 0.8 ml of phenol-chloroform (ph8.0) by vortexing. Samples were re-extracted with phenol-chloroform (ph8.0) and nucleic acids were precipitated at -20 C using 0.3 M sodium acetate (ph6.0) and an equal volume of isopropanol. After centrifugation, nucleic acids pellet was washed with 70% ethanol, dissolved in DNase I buffer, then treated with 5 units of 2
DNase I at 37 C for 30 min. Samples were extracted with phenol-chloroform (ph8.0) and pecipitated again as described above. After centrifugation, RNA pellets were dissolved in RNasefree distilled water and stored at -80 C. Primers for prt-pcr analysis of vanh and sige transcription were designed using Primer3 (http://frodo.wi.mit.edu/). The primer pairs used for this study were as follows: for vanh, 5 - ACGAGAATCACGGTTTACGG (qvanh-f) and 5 -CTTGTGGTCAATGCTTATGC (qvanh-r); for sige, 5 -CTGATGGACGTCCTGAAGGT (qsige-f) and 5 -GTCTCCTCCGTCGACATCTG (qsige-r). The qrt-pcr analyses were performed using 2.5 μg of total RNAs. Each RNA sample was subjected to RNase-free DNaseI treatment (Invitrogen, amplification grade) in a 20 μl reaction volume. For cdna synthesis, 8 μl of the DNaseI-treated RNA was used as template in a 20 μl reaction volume employing Superscript III First Strand Synthesis Supermix (Invitrogen). PCR cycling was performed at 25 C for 10 min, 42 C for 120 min, 50 C for 30 min, 55 C for 30 min and then 85 C for 5 min. Each PCR product was then treated with RNaseH and diluted 100 times in DNase-free distilled water. 2.5 μl aliquots of each cdna sample were subjected to prt-pcr analysis in total 25 μl reaction volumes with SYBR GreenER qpcr Supermix (Invitrogen) according to the manufacturer s instructions. Each 25 μl reaction solution contained 12.5 μl of SYBR GreenER qpcr Supermix, 250 nm Rox, 200 nm of forward and reverse primers and 3 μl of 40% DMSO. qrt-pcr cycling was performed in a 7300 Real Time PCR System (Applied Biosystems) at 50 C for 2 min, 95 C for 10 min, followed by 30 cycles of 95 C for 15 s and 57 C for 1 min. The results were analysed using 7300 system SDS Software (version 1.4, Applied Biosystems). qrt-pcr determinations were performed in triplicate on each RNA sample and average abundances used. To simplify the pattern of induction for vanh and sige by each glycopeptide compound tested, the data shown in Fig. 3 was normalized relative to the level of expression at time 0 which was defined as 1. 3
SUPPLEMENTARY TABLES TABLE S1 Copy number of sige obtained from qrt-pcr (average and standard deviation (stdev) of triplicate measurements). Compounds Group 1 Group 2 Group 3 Group 4 Damaged Glycopeptide Derivatives Time 0 min 30 min 60 min 90 min 1a average 2.36E+05 1.06E+06 5.67E+05 3.52E+05 stdev 62134.56185 182059.4416 288156.8714 111363.6612 1b average 2.24E+05 1.07E+06 6.40E+05 4.43E+05 stdev 83194.75465 224549.3103 78382.27344 148710.9369 1c average 1.92E+05 9.17E+05 7.49E+05 5.82E+05 stdev 11494.02073 114271.2843 205151.8522 152161.8484 1d average 2.10E+05 1.07E+06 9.90E+05 6.47E+05 stdev 9.46E+04 1.61E+05 35921.21008 139774.8189 1e average 1.99E+05 9.20E+05 8.18E+05 6.21E+05 stdev 43965.89587 47634.02146 80027.07875 25423.08662 1f average 1.93E+05 9.47E+05 6.95E+05 5.06E+05 stdev 70395.25873 147272.0317 263701.8371 46288.99407 1g average 2.04E+05 1.06E+06 5.31E+05 2.05E+05 stdev 74639.33438 198524.4506 83756.2865 117707.8893 2a average 2.32E+05 1.03E+06 9.89E+05 5.77E+05 stdev 87807.28999 91101.51637 148304.2228 36959.76435 2b average 2.26E+05 8.51E+05 9.31E+05 6.51E+05 stdev 115886.1023 64743.38016 145483.5644 106357.8413 2c average 2.00E+05 7.26E+05 7.50E+05 5.90E+05 stdev 86308.84611 188620.9253 197702.2385 73198.92289 2d average 2.26E+05 8.65E+05 7.92E+05 7.71E+05 stdev 43878.62046 138297.9875 104174.533 165157.5006 3a average 1.72E+05 9.27E+05 9.40E+05 7.08E+05 stdev 15861.67789 68465.09485 241247.2523 168302.5388 3b average 1.76E+05 6.69E+05 7.93E+05 1.01E+06 stdev 111878.194 33919.91229 170569.4545 162588.6259 3c average 1.88E+05 7.53E+05 7.76E+05 9.09E+05 stdev 65289.90716 73310.55079 94263.16791 261837.8453 3d average 2.24E+05 7.86E+05 8.98E+05 9.45E+05 stdev 36769.55262 82123.89015 70710.67812 66725.8071 3e average 2.26E+05 6.68E+05 6.96E+05 9.05E+05 stdev 38991.45205 84884.23489 18009.25688 108894.4443 3f average 2.12E+05 5.95E+05 7.69E+05 8.88E+05 stdev 23629.07813 1.90E+05 1.38E+05 2.31E+05 3g average 2.14E+05 7.87E+05 8.23E+05 1.02E+06 stdev 41198.70548 47031.90407 142029.3397 158197.1344 4a average 1.99E+05 8.73E+05 9.39E+05 1.12E+06 stdev 3.26E+04 1.13E+05 156511.4712 63971.9992 4b average 1.83E+05 8.01E+05 8.91E+05 1.05E+06 stdev 73916.01126 110663.9458 238880.1202 195093.8218 4c average 1.69E+05 8.11E+05 9.78E+05 1.08E+06 stdev 76083.16389 257975.8883 287720.1432 42869.76282 4d average 2.10E+05 8.12E+05 9.13E+05 1.04E+06 stdev 17546.03469 106368.479 31533.05144 143500.2904 D-1a average 2.15E+05 2.55E+05 2.01E+05 2.18E+05 stdev 21031.72207 50911.68825 94001.77303 80002.08331 D-4a average 2.02E+05 2.33E+05 2.41E+05 1.99E+05 stdev 59774.57654 48536.9962 75021.86348 20835.30657 D-3f average 1.63E+05 4.61E+05 4.29E+05 5.21E+05 stdev 77650.52156 5.75E+04 2.34E+05 9.10E+04 D-4d average 2.08E+05 3.45E+05 3.79E+05 4.48E+05 stdev 45829.39377 44994.11073 136263.5314 48774.99359 4
TABLE S2 Copy number of vanh obtained from qrt-pcr (average and standard deviation (stdev) of triplicate measurements). Compounds Group 1 Group 2 Group 3 Group 4 Damaged Glycopeptide Derivatives Time 0 min 30 min 60 min 90 min 1a average 1.37E+03 9.80E+05 7.06E+05 5.39E+05 stdev 3.89E+02 3.42E+05 1.94E+05 9.74E+04 1b average 1.02E+03 9.66E+05 9.51E+05 6.07E+05 stdev 490.8008607 92577.4267 92442.65019 152744.6254 1c average 1.57E+03 8.98E+05 4.38E+05 2.22E+05 stdev 468.6149806 105509.8732 4618.802154 23797.759 1d average 5.76E+02 7.31E+05 3.69E+05 2.18E+05 stdev 175.4194972 268700.5769 68006.37118 31214.31296 1e average 5.99E+02 4.04E+05 1.70E+05 7.88E+04 stdev 166.656333 148095.6898 44410.95961 16404.97892 1f average 1.73E+03 2.13E+05 1.35E+05 8.37E+04 stdev 413.1475524 99960.65512 45237.67792 26556.83188 1g average 1.54E+03 1.06E+06 6.92E+05 1.28E+05 stdev 310.4425251 225323.7344 166287.9636 62602.2287 2a average 9.71E+02 1.64E+04 9.80E+05 4.10E+05 stdev 66.65884562 9448.598273 16310.12501 81859.98429 2b average 1.06E+03 4.03E+04 8.10E+05 1.86E+05 stdev 427.773338 18859.74207 268726.793 62371.86194 2c average 1.63E+03 1.19E+05 2.24E+05 1.07E+05 stdev 503.8849075 21484.95598 156783.747 15730.33163 2d average 5.83E+02 7.92E+04 5.59E+05 3.92E+05 stdev 244.761789 14752.73986 130511.315 167690.3732 3a average 1.10E+03 1.95E+04 9.75E+04 5.90E+03 stdev 412.6867529 6708.685305 6968.53923 1877.154386 3b average 9.49E+02 1.54E+03 1.09E+03 8.65E+02 stdev 144.4409206 511.3515099 292.8991083 131.4511506 3c average 1.16E+03 1.42E+03 1.04E+03 1.06E+03 stdev 618.0113268 263.5669175 246.5431402 199.0831884 3d average 5.35E+02 1.04E+03 8.17E+02 6.40E+02 stdev 71.45161533 91.92388155 68.06859286 227.1563338 3e average 5.10E+02 1.35E+03 1.04E+03 8.97E+02 stdev 401.0037406 372.1993194 112.4470246 190.0876991 3f average 5.95E+02 8.17E+02 6.75E+02 8.26E+02 stdev 1.64E+02 160.5132393 110.6631526 260.1352212 3g average 5.40E+02 1.23E+03 9.20E+02 5.72E+02 stdev 1.47E+02 925.8795818 86.96167738 184.0579619 4a average 1.27E+03 3.08E+03 1.74E+02 1.25E+03 stdev 2.20E+02 4.09E+02 6.26E+02 327.4342803 4b average 9.64E+02 3.13E+03 1.03E+03 8.27E+02 stdev 466.0053251 3367.905581 397.9225218 146.5940767 4c average 1.03E+03 1.49E+03 9.66E+02 1.04E+03 stdev 70.56925676 165.2271164 101.6579231 286.3255723 4d average 6.83E+02 1.08E+03 8.77E+02 8.58E+02 stdev 115.6762724 70.94598885 187.705443 213.3690074 D-1a average 8.62E+02 9.37E+02 7.08E+02 8.22E+02 stdev 140.3436259 131.5256629 211.0071089 148 D-4a average 6.89E+02 8.42E+02 4.01E+02 5.84E+02 stdev 384.666089 205.125165 274.66161 229.0422086 D-3f average 6.85E+02 8.12E+02 6.82E+02 7.49E+02 stdev 177.4974178 87.78572397 108.315896 139.5026881 D-4d average 8.67E+02 1.07E+03 8.93E+02 9.96E+02 stdev 74.50503339 100.6826698 251.1520124 210.0960098 5
REFERENCES 1. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA. 2000. Practical Streptomyces genetics. The John Innes Foundation, Norwich. 2. Hong H-J, Hutchings MI, Neu JM, Wright GD, Paget MS, Buttner MJ. 2004. Characterisation of an inducible vancomycin resistance system in Streptomyces coelicolor reveals a novel gene (vank) required for drug resistance. Mol. Microbiol. 52:1107-1121. 3. Kwun MJ, Novotna G, Hesketh AR, Hill L, Hong H-J. 2013. In vivo studies suggest that induction of VanS-dependent vancomycin resistance requires binding of the drug to D-Ala-D-Ala termini in the peptidoglycan cell wall. Antimicrob. Agents Chemother. 57:4470-4480. 4. Hesketh A, Kock H, Mootien S, Bibb M. 2009. The role of absc, a novel regulatory gene for secondary metabolism, in zinc-dependent antibiotic production in Streptomyces coelicolor A3(2). Mol. Microbiol. 74:1427-1444. 6