Electronic Supplementary Information An anti-galvanic replacement reaction of DNA templated silver nanoclusters monitored by light-scattering technique Guoliang Liu, a Da-Qian Feng, a Wenjie Zheng, a Tianfeng Chen, a Dan Li* b a Department of Chemistry, School of Life Science and Technology, Jinan University, Guangzhou 510632, China. b Department of Chemistry and Research Institute for Biomedical and Advanced Materials, Shantou University, Guangdong 515063, China. Fax: (+86) 754-82902767; E-mail: dli@stu.edu.cn
Experimental Section Materials and Measurements: Silver nitrate (AgNO 3 ), 99.99%, and sodium borohydride (NaBH 4 ), 98%, were purchased from Alfa Aesar and used without further purification. The DNA oligonucleotides were purchased from Sangon (Shanghai, China). All other reagents were all of analytical grade. The solutions were prepared with MilliQ water (18.2 MΩ. cm) from a Millipore system. Unless otherwise noted, experiments were carried out in 10 mm Tris/HCl buffer solution (ph 7.0). The light-scattering spectra were measured with a model LS-55 spectrofluorometer (Perkin-Elmer, USA). Fluorescence measurements were performed by a FLS-920 picosecond fluorescence lifetime spectrometer (Edinburgh Instruments, UK). UV-vis spectra were determined by an Agilent 8453 UV-vis spectrophotometer (Agilent Technologies Co. Ltd., USA). XPS measurements were implemented on a Thermo ESCALAB 250 instrument configured with a monochromated Mg Kα (1486.8 ev) 150 W X-ray source, 0.5 mm circular spot size, a flood gun to counter charging effects, and the analysis chamber base pressure < 1 10 9 mbar; data were collected with FAT = 20 ev. The takeoff angle, defined as the angle between the substrate normal and the detector, was fixed at 0. The samples were dropped on the surface of the silicon substrate by natural evaporation. All binding energies were calibrated using either the Au 4f7/2 peak (84.0 ev) or the C 1s carbon peak (284.6 ev). HR-TEM images were taken with a JEM-2011 high-resolution transmission electron microscopy operating at 200 kv. The as-prepared Ag nanoclusters were dried on carbon-coated copper grids by slow natural evaporation. The fluorescence lifetimes were recorded by Fluorescence lifetime spectrometer C11367 instrument. Mass spectra were obtained on a MALDI-TOF-MS (Bruker Daltonics Inc. BIFLEX III) with a 3-HPA matrix in linear mode. Preparation of silver nanoclusters (Ag NCs) For the preparation of the DNA-Ag NCs, certain volume of AgNO 3 solution was introduced into aliquot volume of DNA solution in 10 mm Tris/HCl buffer solution (ph 7.0). The mixture was kept at 0 C for 15 minutes. Then, the mixture was reduced by quickly adding NaBH 4 (must be freshly prepared before use) under vigorously shaking for 2 min. 1 Final concentrations were 15 μm in the DNA template, 90 μm in AgNO 3 and 90 μm in NaBH 4. The reaction mixture was kept S1
in the dark at 4 C for another 3 hours before use. The light-scattering spectrum of DNA-Ag NCs in the presence of Cu 2+ ions Certain volume of the sensor solution was added into a test tube. Then, a series of solutions of copper ions were pipetted into the test tubes by using microsyringes before light-scattering measurement. The light-scattering spectrum was then measured by scanning simultaneously the excitation and emission monochromators (Δλ = 0.0 nm) from 250 to 700 nm with the excitation and emission slits 5 nm. 2-4 Based on the spectra, LS intensities were obtained at the maximum peak. Spectrum curves were made based on the data collected on the first minute after adding the solution of Cu 2+ ions. The fluorescence spectrum of DNA-Ag NCs in the presence of Cu 2+ ions A varied of solutions of copper ions were pipetted into the sensor by using microsyringes before fluorescence measurement. Fluorescence spectra were made based on the data collected on the first minute after the addition of Cu 2+ ions. 5 References 1 J. T. Petty, J. Zheng, N. V. Hud and R. M. Dickson, J. Am. Chem. Soc., 2004, 126, 5207-5212. 2 D. Q. Feng, G. L. Liu, W. J. Zheng, J. Liu, T. F. Chen and D. Li, Chem. Commun., 2011, 47, 8557-8559. 3 G. L. Liu, D. Q. Feng, T. F. Chen, D. Li and W. J. Zheng, J. Mater. Chem., 2012, 22, 20885-20888. 4 D. Q. Feng, G. L. Liu, W. J. Zheng, T. F. Chen and D. Li, J. Mater. Chem. B, 2013, 1, 3057-3063. 5 G. L. Liu, D. Q. Feng, X. Y. Mu, W. J. Zheng, T. F. Chen, L. Qi and D. Li, J. Mater. Chem. B, 2013, 1, 2128-2131. S2
Table S1. DNA sequences of the preparation of ssdna-ag NCs. The sequences of all oligonulceotides are listed in the 5 to 3 direction. Name (ssdna) Sequences (5-3 ) DNA size (bp) ODN1 CGCTAACGCTAACGCTAACGCTA 23 ODN2 GGCTAAGGCTAAGGCTAAGGCTA 23 S3
a) Fluorescence Intensity 1.0 0.8 0.6 0.4 0.2 466 nm 554 nm 0.0 400 450 500 550 600 650 700 Wavelength (nm) b) Fluorescence intensity 1.0 0.8 0.6 0.4 0.2 453 nm 515 nm 0.0 400 450 500 550 600 650 Wavelength (nm) Figure S1. The excitation (black) and emission (red) spectra of ssdna templated silver nanoclusters. The ssdna templates are (a, ODN1) 5 -(CGCTAA) 3 CGCTA-3, (b, ODN2) 5 - (GGCTAA) 3 GGCTA-3. All DNA sequences are shown in 5-3. S4
Table S2. Optical properties of ssdna templated silver nanoclusters. Silver Nanoclusters Excitation peak (nm) Emission peak (nm) Color ODN1 ssdna-ag NCs 466 554 yellow green ODN2 ssdna-ag NCs 453 515 green S5
a) 1000 Counts 100 10 Residuals 4 2 0-2 -4 0 10 20 30 Time (ns) 0 10 20 30 40 Time (ns) b)1000 4 Counts 100 10 Residuals 2 0-2 -4 0 10 20 30 40 50 Time (ns) 10 20 30 40 Time (ns) Figure S2. Fluorescence decay curves of ODN1 ssdna-ag NCs (a) and ODN2 ssdna-ag NCs (b) in Tris-HCl buffer solution (ph 7.0). The inset shows a random distribution of the weighted residuals around zero. S6
Table S3. Fluorescence decay parameters for ODN1 ssdna-ag NCs and ODN2 ssdna-ag NCs. Samples Fitting CHI (ns) ODN1 ssdna-ag NCs 3 rd order 1.194 2.35 ODN2 ssdna-ag NCs 2 nd order 1.759 2.31 S7
LS Intensity 300 250 200 150 100 50 6 1 I-I 0 300 240 180 120 60 0 0.0 0.4 0.8 1.2 1.6 C Cu 2+( M) 0 300 400 500 600 700 Wavelength (nm) Figure S3. Light-scattering spectra of ODN2 ssdna templated silver nanoclusters in the absence and presence of various concentrations of copper (II) ions solution at room temperature. Conditions: 1 (black), buffer solution; 2 (red), ODN2 ssdna-ag NCs; 3-6: 2 + Cu 2+ ions (µm): 0.125 (green), 0.375 (blue), 0.75 (cyan), 1.5 (magenta). The inserted figure reveals the plot of the increment of the light-scattering intensity of ODN2 ssdna-ag NCs versus the concentration of copper (II) ions. S8
Figure S4. The TEM image of synthesized ODN1 ssdna-ag NCs in the presence of 1 mm Cu 2+ ions solution at room temperature, scale bar: 50 nm. S9
Table S4. The parameters of the interaction between ssdna-ag NCs and copper ions by light-scattering spectrum. ssdna-ag NCs Stability Constant (K s, L/mol) Stoichiometry (n) ODN1 ssdna-ag NCs 7.7267 10 6 2.7195 ODN2 ssdna-ag NCs 5.3217 10 6 2.1296 S10
a) Absorbance 1.0 0.8 0.6 0.4 0.2 0.0 6 1 400 500 600 700 800 Wavelength (nm) b) Absorbance 1.0 0.8 0.6 0.4 0.2 5 1 0.0 300 400 500 600 700 800 Wavelength (nm) Figure S5. UV-vis spectra of the ssdna-ag NCs in the absence and presence of Cu 2+ ions solution at room temperature. Conditions: (a) 1 (black), ODN1 ssdna-ag NCs; 2-6: 1 + Cu 2+ ions (µm): 0.5 (red), 1 (green), 2 (blue), 3 (cyan), 4 (magenta); (b) 1 (black), ODN2 ssdna-ag NCs; 2-5: 1 + Cu 2+ ions (µm): 0.5 (red), 1 (green), 2 (blue), 3 (cyan). S11
a) Counts 6x10 4 5x10 4 4x10 4 3x10 4 2x10 4 1 10 F/F 0 1.0 0.8 0.6 0.4 0.2 0.0 0 150 300 450 600 C 2+ Cu ( M) 1x10 4 0 500 550 600 650 700 Wavelength (nm) b)1.4x10 4 Counts 1.2x10 4 1.0x10 4 8.0x10 3 6.0x10 3 4.0x10 3 2.0x10 3 0.0 1 10 F/F 0 1.0 0.8 0.6 0.4 0.2 0.0 0 150 300 450 600 C 2+ Cu ( M) 500 550 600 650 700 Wavelength (nm) Figure S6. Emission spectra of ssdna-ag NCs in the presence of increasing concentrations of Cu 2+ ions solution. (a) 1, ODN1 ssdna-ag NCs; 2-10, 1 + Cu 2+ ions (µm): 0.5, 2.5, 5, 10, 20, 40, 80, 320, 640; (b) 1, ODN2 ssdna-ag NCs; 2-10, 1 + Cu 2+ ions (µm): 0.5, 2.5, 5, 10, 20, 40, 80, 320, 640. The inserted figure displays the curves between the fluorescence ratio (F/F 0 ) and various concentrations of copper (II) ions. S12
a) Intensity (a.u.) 1700 1600 1500 1400 1300 7138 ODN2 1200 6000 6500 7000 7500 8000 m/z b) Intensity (a.u.) 5400 5200 5000 4800 4600 4400 4200 7140 ODN2 7356 ODN2+Ag 2 7464 ODN2+Ag 3 7570 ODN2+Ag 4 6000 6500 7000 7500 8000 m/z S13
c) Intensity (a.u.) 8200 8000 7800 7600 7400 7145 ODN2 7357 ODN2+Ag 2 7467 ODN2+Ag 3 7200 6900 7050 7200 7350 7500 m/z 7520 ODN2+Ag 3 Cu 1 Figure S7. MALDI-TOF mass spectra of ODN2 ssdna (a), synthesized ODN2 ssdna-ag NCs in the absence (b) and presence (c) of 1 mm Cu 2+ ions. S14
a) Intensity (a.u.) Ag 3d 5/2 366 368 370 372 374 376 Binding Energy (ev) b) Intensity (a.u.) 930 935 940 945 950 Binding energy (ev) Figure S8. (a) Ag3d XPS spectrum of prepared ODN2 ssdna-ag NCs. (b) Cu2p XPS spectra of ODN2 ssdna-ag NCs in the presence of Cu 2+ ions solution (1 mm). S15
Table S5. The Ag/Cu atom ratios calculated by XPS analysis. ssdna-ag NCs Ag/Cu atom ratios ODN1 ssdna-ag NCs 2.18:1 ODN2 ssdna-ag NCs 1.29:1 S16
a) 10 8 Pb 2+ (I-I 0 )/I 0 6 4 2 0 Control Ag + K + Na + Ca 2+ Cd 2+ Cu 2+ Hg 2+ Co 2+ Ni 2+ Metal ions Zn 2+ Fe 2+ b) 10 Hg 2+ Pb 2+ 8 (I-I 0 )/I 0 6 4 2 0 Control Ag + K + Na + Ca 2+ Cd 2+ Cu 2+ Co 2+ Metal ions Ni 2+ Zn 2+ Fe 2+ Figure S9. AGRR of DNA-Ag NCs with metal ions monitored by light-scattering technique. (a), ODN1 ssdna-ag NCs; (b), ODN2 ssdna-ag NCs. Conditions: The concentrations of metal ions used: Ag +, 100 mm; K +, Na +, 10 mm; other metal ions, 1 mm. S17