Genome Editing with Programmable Nucleases Jin-Soo Kim Department of Chemistry Seoul National University 1
Method of the Year 2011: Engineered Nucleases
RNA-guided Cas9 Endonuclease 3
FokI and the First ZFN Y.-G. Kim S. Chandrasegaran DNA-binding Nuclease 5 3 5 3 FokI is a type IIS restriction enzyme. FokI consists of two modular domains; DNA-binding domain and nuclease. DNA-binding domain of FokI can be replaced w/ other DNA-binding domains.
Targeted mutagenesis in Drosophila using ZFNs ZF1 ZF2 ZF3 FokI Nuclease FokI Nuclease ZF3 ZF2 ZF1 5 3 3 5 Dana Carroll Zinc finger-foki nuclease fusion proteins function as site-specific endonucleases. Two 3-finger proteins could recognize a unique site (18 bp) in a genome. ZFNs induce site-specific DSBs in cells. DSBs are repaired by endogenous mechanisms, HR or NHEJ. 5
Cys 2 -His 2 Zinc Finger finger 1 finger 2 finger 3 Arg 6 Asp 2 Arg -1 Arg 6 Asp 2 Arg -1 His 3 Asp 2 Arg -1 T G C A G C G G G C T G C 5 3 G C C G C A C Pavletich & Pabo (1993) Science. 261, 1701. Found in fungi, plants, animals and human 6,500 zinc finger sequences exist in the human genome. Modular head-to-tail arrangement A single zinc finger module interacts w/ a 3-bp subsite. Carl Pabo 6
Modular Assembly of Zinc Finger Arrays Zinc finger-dna interaction directory Modular assembly 3-bp subsite GAA GAC GAG GAT GCA GCC GCG GCT Zinc finger QSNR CSNR RSNR ISNR QSSR DSCR RDER VSTR QSNR RSNR CSNR CO 2 H NH 2 GAA GAG GAC Target sequence C 5 3 Bae et al. (2003) Nat. Biotechnol. 21, 242. Zinc fingers recognizing diverse 3-bp subsites were isolated from the human genome. 8
Zinc Finger Transcription Factor Library A Random shuffling X AD RD AD AD RD RD Zinc fingers ZFPs ZFP-TF library B AD AD RD RD Transformation AD AD AD ZFP-TF vector library + or transfection RD Screening RD RD AD Mammalian or microbial cells ZFPs expressed in cells Altered cellular phenotype Park et al. (2003) Nat. Biotechnol. 21, 1208.
Preassembled Zinc-Finger Arrays 10
Targeted Gene Knockout in Animals B sam2 in zebrafish habenula (adult) Prof. CH Kim at CNU Novel C-C chemokine RNA transcripts encoding ZFNs were injected into one-cell embryos. >20 genes were successfully targeted using our ZFNs in zebrafish, medaka, and frogs. 11
ZFNs are associated with cytotoxicity T7E1 assay Kim et al. (2009) Genome Res. 19, 1279. ZFN-induced mutations often disappear at day 9 post-transfection. Mammalian cell lines are much more susceptible to ZFN cytotoxicity. >100 clones need to be analyzed to obtain a single KO clone. 12
Transcription Activator-Like (TAL) Effectors J. Boch et al. Science 2009 M.J. Moscou et al. Science 2009 13
TALEN activity (% of GFP+ cells) Optimized TALEN Architectures TALEN-L TALEN-L 25 20 15 10 5 8 bp 9 bp 10 bp 11 bp 12 bp 13 bp 14 bp 15 bp 16 bp 17 bp 18 bp 19 bp 20 bp 21 bp 0 L1 L2 L3 L4 S+28 S+63 Variable fusion junctions
Genome-Scale Assembly of TALENs One-step Golden Gate cloning system using 424 TALE arrays and 8 FokI plasmids. 18,740 TALENs that target every protein-coding gene in the human genome. Kim et al. (2013) Nature Biotechnol. 31, 251.
>99% Success Rate of TALENs No. of TALENs TALEN TALEN 16 TALEN FKTN OPN1SW ABCC11 TMEM67 SOBP 14 12 Indels (%) TALEN 54 * * 46 * * * SRPX2 TXNDC3 UPB1 39 26 * CYP27B1 * * * * * * Indels (%) 19 14 4.0 <0.5 <0.5 7.7 * * FGFR3 10 8 6 4 2 0 Mutation frequency (%) Mutation frequencies are measured using T7 endonuclease I.
TALEN Library Resource http://www.talenlibrary.net 18,740 pre-assembled TALENs; 169,362 designed TALENs for 18,740 human genes Since March 2013, we provided SNU TALENs to >80 labs around the world.
18
Gene KO Cells Created Using TALENs Relative luciferase activity Wild type 292bp 261bp 282bp 288bp aattgatgttcgtccctgtcctcttaacccaaatgaacacaaaggcactataacttggtataaagatgacagc WT aattgatgttcgtccctgtcctct-------------------------------tggtataaagatgacagc 31 aattgatgttcgtccctgtcctcttaacccaaa----cacaaaggcactataacttggtataaagatgacagc 4 aattgatgttcgtccctgtcctcttaacccaaa----------ggcactataacttggtataaagatgacagc 10 WT KO TNFR1 IL1R1 TNFR1 IL1R1 TNFR1 GAPDH 140 120 100 TNFα IL-1β ( - ) 80 60 40 20 0 - sictrl sitnfr1 siil1r1 - - - WT WT WT WT TNFR1 KO IL1R1 KO TNFR1 / IL1R1 KO
TNFR1 KO cells created using TALENs TNFR1 WT TNFR1 KO 20
Targeted Gene Knockout in Mice Prof. Han-Woong Lee at Yonsei Univ. RNA transcripts encoding ZFNs/TALENs were injected into the embryos. 49 to 77% of F0 contained mutations.
Hemophilia: The Royal Disease Queen Victoria (1819-1901) Queen Victoria and her royal family British Queen Victoria was a carrier of the hemophilia gene. Almost half of the severe form of hemophilia A is caused by DNA inversion. 22
ZFN-induced Inversion of the Hemophilia Gene WT Z10 target site(homology 1) Z10 target site(homology 2)..caaggagacccactgagttgggcaaaggtggggccgac..140kbp..GTCGGCCCCACCTTTGCCCAACTCAGTGGGTCTCCTTG....gttcctctgggtgactcaacccgtttccaccccggctg..140kbp..CAGCCGGGGTGGAAACGGGTTGAGTCACCCAGAGGAAC.. Cleaved..caaggagacccactga gttgggcaaaggtggggccgac..140kbp..gtcggccccacctttgcc CAACTCAGTGGGTCTCCTTG....gttcctctgggtgactcaac ccgtttccaccccggctg..140kbp..cagccggggtggaaacgggttg AGTCACCCAGAGGAAC.. Flipped..caaggagacccactga GTTGGGCAAAGGTGGGGCCGAC..140kbp..gtcggccccacctttgcc CAACTCAGTGGGTCTCCTTG....gttcctctgggtgactcaac CCGTTTCCACCCCGGCTG..140kbp..cagccggggtggaaacgggttg AGTCACCCAGAGGAAC.. Breakpoint junction 1 Breakpoint junction 2..agtcggccccacctttgcccaa----ctcagtgggtctccttg.. (X6)..agtcggc-----------ccaa----ctcagtgggtctccttg.. (X1)..agtcggccccacctttgcccaa---------------------.. (x1)..agtcggccccacctttgcccaaccaactcagtgggtctccttg.. (X2) Lee et al. (2012) Genome Res. 22, 539. 23
Stem Cell Therapy: Gene Correction in ips Cells Biopsy Patient somatic cells Reprogramming ips cells Patient Gene correction via Nucleases Transplantation Differentiation Gene-corrected ips cells Gene-corrected cells 24
CRISPR: Adaptive Immune System in Prokaryotes Clusters of Regularly Interspaced Palindromic Repeats Cas9/crRNA/tracrRNA: RNA-guided programmable restriction enzymes 25
RNA-Guided ENdonuclease (RGEN) Cas9 Guide RNA G G G G
Cloning-Free Gene Knockout in Human Cells CCR5 Cas9 plasmid : Guide RNA : - + - - + C4BPB Cas9 plasmid : Guide RNA : - + - - + Indels (%) : 3.5 7.0 13 13 Indels (%) : 9.3 15 19 23 CAATCTATGACATCAATTATTATA-CATCGGAGCCCTGCCAAAAAATCAA WT CAATCTATGACATCAATTATTATAACATCGGAGCCCTGCCAAAAAATCAA +1 CAATCTATGACATCAATTATTAT--------------GCCAAAAAATCAA -13 CAATCTATGACATC---------------GGAGCCCTGCCAAAAAATCAA -14 CAATCTATGACAT-------------------GCCCTGCCAAAAAATCAA -18 CAATCTATGACATCAATTATTAT--------------------AAATCAA -19 CAATCTATGACATC-------------------------CAAAAAATCAA -24 CAATCTATGACA-------------------------------AAATCAA -30 TATGTGCAATGACCACTACATCCT--CAAGGGCAGCAATCGGAGCCAG WT TATGTGCAATGACCACTACATCCTT-CAAGGGCAGCAATCGGAGCCAG +1 TATGTGCAATGACCACTACATCCTCTCAAGGGCAGCAATCGGAGCCAG +2 TATGTGCAATG------------------------------GAGCCAG -30 TATGTGCAATGAC----------180 bp------------------- -180 Synthetic guide RNA rather than plasmids encoding guide RNA were used.
RNA-Guided Gene KO in Animals Prof. Han-Woong Lee at Yonsei Univ. Genetics in press; Genome Res. in press Recombinant Cas9 complexed w/ guide RNA was tested in vitro first. Active ribonucleoproteins were injected into one-cell embryos. Up to 93% of newborn mice carried mutations. RGEN proteins induced mutations in zebrafish, fruitfly, C. elegans, etc. 28
Paired ZF Nickase ZFN-R T7 endonucleases I assay D450A FokI GTCATCCTCATCCTGATAAACTGCAAAAG ZFN ZF nickase pair ZF nickase CAGTAGGAGTAGGACTATTTGACGTTTTC FokI ZFN-L Indels (%) 10 15 8 10 19 Kim et al. (2012) Genome Res. 22, 1327. Two adjacent nicks produced by paired nickases yield a composite DSB. Paired nickases induce mutations at high frequency in human cells. 29
Comparison of Engineered Nucleases ZFN TALEN RGEN Success rate ~24% >99% ~90% Average mutation rate <10% ~20% ~20% Length of target site 18 to 36 bp 30 to 40 bp 23 bp Restriction in target site Guanine-rich Start with T and end with A End with GG (PAM) Design density One per ~100 bp One per every bp One per 8 bp Off-target effects High Low Low? Size 2 x ~2 kbp 2 x ~3 kbp 4.2 kbp + grna 30
Engineered Nucleases: Restriction enzymes in the post-genomic era Gene knock-out and knock-in Genome rearrangements: deletion, duplication, inversion, translocation Gene knockout studies in cell lines Targeted mutagenesis in research organisms: zebrafish, C. elegans etc. Plant and animal biotechnology: applications in agriculture, fishery etc. Stem cell research and cell/gene therapy 31