Biology Day 67 Tuesday, February 24 Wednesday, February 25, 2015
Do#Now:' Brainstorm+8.5 + 1. Write today s FLT! 2. Identify 3 specific differences between DNA and RNA.! 3. is the process of making RNA from DNA; it takes place in the cell s.! 4. If a DNA strand is TACAGCGGAT?! a. Write the complementary DNA strand! b. Write the complementary mrna strand
Announcements' Upcoming' Progress'report'grades'due'Fri.' 2/27'
Announcements' Upcoming' Table'of'Contents'due'&'Ch.'8' Test:' P.'1:'Tuesday,'March'3' P.'3,'6:'Wednesday,'March'4'
Announcements' Quarter'3'ends'Friday,'April'10' Q3'Midterm' 'week'of'april'6'(right' arer'spring'break)' Students'who'have'70%'or'higher'on' their'tests'this'quarter'and'less'than' 5'missing'assignments'will'be'exempt'
Planner: Study Guide 8.5 Table of Contents & test 3/4 Table of Contents #6 20. Brainstorm 8.5 21. Power Notes 8.5 22. Study Guide 8.5
Brainstorm Protocol You will have one minute and thirty seconds to generate answers The winning group will get +5 dojo points each or a treat Your topic is.
Brainstorm Protocol Tell me all about DNA and the central dogma 1:30 1:29 1:28 1:27 1:26 1:25 1:24 1:23 1:22 1:21 1:20 1:19 1:18 1:17 1:16 1:15 1:14 1:13 1:12 1:11 1:10 1:09 1:08 1:07 1:06 1:05 1:04 1:03 1:02 1:01 1:00 0:59 0:58 0:57 0:56 0:55 0:54 0:53 0:52 0:51 0:50 0:49 0:48 0:47 0:46 0:45 0:44 0:43 0:42 0:41 0:40 0:39 0:38 0:37 0:36 0:35 0:34 0:33 0:32 0:31 0:30 0:29 0:28 0:27 0:26 0:25 0:24 0:23 0:22 0:21 0:20 0:19 0:18 0:17 0:16 0:15 0:14 0:13 0:12 0:11 0:10 0:09 0:08 0:07 0:06 0:05 0:04 0:03 0:02 0:01 End
Standard HS-LS 1-1: Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells. FLT I will be able to describe how mrna codons are translated into amino acids by completing Power Notes 8.5
Video Clip: Watch Now that we ve learned a bit more about DNA Explain the video to your neighbors
Power Notes 8.5 Noise level 0 Copy down all bolded ideas Raise your hand to question/ comment Be prepared to pair-share
8.5: Translation Key Concept: Translation coverts an mrna message into a polypeptide, or protein
Central Dogma of Molecular Biology Recall: the central dogma of molecular biology shows the flow of information in cells
Write on top: Translation = Converts mrna into a protein (polypeptide) at ribosomes! To do this, the mrna nucleotides must be translated into amino acids
Reading Frame mrna is read as sequences of 3 nitrogenous bases (codons)! The reading frame begins with a start codon and ends with a stop codon
Reading Frame Changes in the reading frame can change the resulting protein
Common Language The genetic code is the same among ALL living organisms!
Pair-Share-Respond 1. What is translation?! 2. Where does it take place?! 3. What happens if the reading frame for mrna changes?! 4. What is the amino acid for CCC?! 5. Why is the genetic code called a universal or common language?
Codon = Three-nucleotide sequence that codes for an amino acid
Start Codon Translation always begins at AUG, which translates to AA Methionine
Example What will the amino acid sequence be for the given mrna strand?! CCAGUAAUGGGCAGACCAGAC! Answer:! CCAGUA AUG - GGC- AGA- CCA - GAC! Met - Gly - Arg - Pro - Asp
Stop Codon 3 codons that end translation sequence
Try this one: What are the amino acids that will be translated?! GCACAUGCAGACGUAGGACCA! Answer:! CCAGUA AUG - CAG- ACG- UAG! Met - Gln - Thr (Stop)
Transfer RNA (trna) Type of RNA that carries amino acids from the cytoplasm to the ribosome! Carries an amino acid on top & an anticodon on the bottom
Anticodon 3 nucleotides on trna that are complementary to mrna codon
Pair-Share-Respond 1. What is a codon?! 2. What is the start codon?! 3. What are the stop codons?! 4. What amino acids will be translated from CAUGACAUGACCAGG?! 5. What does trna do?
Ribosome The site of protein synthesis! Made of rrna and proteins! Ribosome forms peptide bonds between amino acids
Ribosome Large subunit: binds to trna Small subunit: binds to mrna
Translation: Parts 1. amino acid! 2. peptide bond! 3. large ribosomal subunit! 4. trna! 5. codons! 6. small ribosomal subunit! 7. mrna! 8. anticodon
Translation Process 1. trna pairs with start codon AUG! 2. Ribosome forms peptide bonds between amino acids as trnas bring them! 3. Translation continues until a stop codon is encountered.
Pair-Share-Respond 1. Where does protein synthesis take place?! 2. What are the bonds between amino acids called?! 3. What amino acid is always translated first?! 4. When does translation end?
CW 1. 8.5 Study Guide 2. Study for quiz!
Biology Day 68 Thursday, February 26 Friday, February 27, 2015
BrainPOP: Mutations! 1. Write today s FLT 2. Draw the central dogma of molecular biology (from 8.3 notes) 3. Under your diagram, add the location in the cell for each step 4. A DNA strand is GTACCCTTGAATCAG a. What would the complementary RNA strand be? b. What would the amino acid sequence be? Use the reading packet p. 244
Announcements' Upcoming' Progress'report'grades'due'Fri.' 2/27' P.6:'Potluck?''' Which'day?''' Tues'3/3#Fri'3/6?'
Announcements' Upcoming' Table'of'Contents'due'&'Ch.'8' Test:' P.'1:'Tuesday,'March'3' P.'3,'6:'Wednesday,'March'4'
Announcements' Quarter'3'ends'Friday,'April'10' Q3'Midterm' 'week'of'april'6'(right' arer'spring'break)' Students'who'have'70%'or'higher'on' their'tests'this'quarter'and'less'than' 5'missing'assignments'will'be'exempt'
Planner: Study Guide 8.7 Get all stamps Table of Contents #6 23. BrainPOP: Mutations 24. Power Notes 8.7 25. Study Guide 8.7
Standard HS-LS 1-1: Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins which carry out the essential functions of life through systems of specialized cells. FLT I will be able to distinguish between different types of mutations that may or may not affect phenotype by completing Power Notes 8.7
Power Notes 8.7 Noise level 0 Copy down all bolded ideas Raise your hand to question/ comment Be prepared to pair-share
8.7: Mutations Key Concept: Mutations are changes in DNA that may or may not affect phenotype
Add at the top Mutation = a change in an organism s DNA (may or may not affect phenotype)! Many kinds of mutations can occur, especially during replication
Add at the top Somatic cell mutations only affect individuals! Gamete/Sex Cell Mutations can be passed on to offspring :(
Some mutations affect a single gene, while others affect an entire chromosome Gene Mutations vs. Chromosome mutations
Mutation Types 1. Chromosomal Mutations! Gene duplication! Translocation! 2. Gene Mutations! Point Mutations! " Missense vs. Nonsense! Frameshift Mutations
Chromosomal Mutations Chromosomal Mutations = Mutations of an entire chromosome (many genes). Often occurs after crossing over.
Chromosomal Mutations 1. Gene duplication = One chromosome has 2 copies of genes & the other has no copies
Chromosomal Mutations 2. Translocation = Gene(s) gets moved to the wrong chromosome
Write small:! Potential Impact Chromosomal mutations large, abnormal effect
Pair-Share-Respond 1. What is a mutation?! 2. Mutations in what kind of cells can be passed on to offspring?! 3. When do chromosomal mutations usually occur?! 4. What are the two types of chromosomal mutations?! 5. What kind of effect do chromosomal mutations usually have on an organism?
Mutation Types 1. Chromosomal Mutations! Gene duplication! Translocation! 2. Gene Mutations! Point Mutations! " Missense vs. Nonsense! Frameshift Mutations
Gene Mutations Write small:! 1. Point Mutation = one nucleotide is substituted for another; may be fixed by DNA polymerase
Write small:! Point Mutations: Potential Impact 1. Missense = a base change that converts one codon into another
Write small:! Point Mutations: Potential Impact 2. Nonsense = change converts a codon into a stop codon
Frameshift Mutation = a nucleotide is inserted or removed, shifting the entire amino acid sequence!! Gene Mutations
Pair-Share-Respond 1. What are the two types of gene mutations?! 2. Label as point or frameshift:! a. AGA AUG UGG CCU UGA goes to AGA AUG UGG GCCU UUG A! b. AGA AUG UGG CCU UGA goes to AGA AUG UGA CCU UGA! 3. What is a nonsense mutation?! 4. What type of gene mutation tends to be the most harmful, and why?
Silent Mutation The genetic code is redundant, so a point mutation may not change the amino acid! Mutations in introns will be removed
Mutagens Mutagens = agents in the environment that can change DNA! Some occur naturally (UV light) and some are man-made (chemicals)
8.7 Study Guide CW You may also work on your binder assignments