Use of a Mycoplasma hyopneumoniae nested polymerase chain reaction test to determine the optimal sampling sites in swine

Transcription

1 J Vet Diagn Invest 14: (2002) Use of a Mycoplasma hyopneumoniae nested polymerase chain reaction test to determine the optimal sampling sites in swine Kathy T. Kurth, Tsungda Hsu, Eric R. Snook, Eileen L. Thacker, Brad J. Thacker, F. Chris Minion Abstract. A number of polymerase chain reaction (PCR)-based diagnostic tests have been developed for Mycoplasma hyopneumoniae, including one from this research group. This report presents further development, optimization, and standardization of a nested PCR test. Detection sensitivity was 1 fg of M. hyopneumoniae chromosomal DNA (approximately 1 organism). This exceeded the sensitivity of or compared favorably with other published PCR tests. Polymerase chain reaction primers to porcine 2-microglobulin were included as internal controls for amplifiable chromosomal DNA from porcine samples. To standardize the test, a number of samples from experimentally infected pigs, including nasal, tonsil, tracheobronchial swabs, lung tissue, bronchial alveolar lavage (BAL) fluid, and tracheobronchial brush samples, were examined by PCR. Samples obtained from BAL fluid and tracheobronchial sites were most predictive of infection, whereas nasal swabs and lung tissue were not reliable indicators of experimentally induced infection. In conclusion, the nested PCR developed for this study was found to be a highly sensitive and specific diagnostic tool for M. hyopneumoniae, but the enhanced sensitivity may be unnecessary if the proper sites are sampled. Porcine enzootic pneumonia caused by Mycoplasma hyopneumoniae continues to produce significant economic losses to swine producers. Mycoplasma hyopneumoniae has recently gained new importance as an integral component of the porcine respiratory disease complex (PRDC). 24 Recent studies indicate that the incidence and severity of enzootic pneumonia have increased with the emergence of porcine reproductive and respiratory syndrome virus and the reemergence of swine influenza virus. Bacterial pathogens such as Pasteurella multocida also contribute to respiratory disease outbreaks. 17 Because of economic consideration, there is increased interest in the swine industry to improve diagnostic methods to gain a better understanding of PRDC in general and to provide farm-specific information for implementing effective prevention or control programs (or both) for M. hyopneumoniae. Reliable diagnostic tests for M. hyopneumoniae are essential for developing cost-effective prevention and control programs. Visual analysis of lungs at the time of slaughter is commonly used to monitor the disease status of a herd. But it is not predictive of lifetime pneumonia. 21 The gold standard for detection of M. hyopneumoniae has been culture of the organism. But culture methods are rarely used because of several reasons: 1) prolonged time before a definitive diagnosis From the Department of Veterinary Microbiology and Preventive Medicine, Veterinary Medical Research Institute, Iowa State University, Ames, IA Current address (Hsu): the Department of Microbiology and Immunology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY Received for publication November 1, is obtained, 2) overgrowth with normal flora bacteria and non M. hyopneumoniae mycoplasmas, and 3) lack of experience and capabilities to perform culture diagnosis of swine tissue samples because of the fastidious nature of M. hyopneumoniae. 18 Detection of serum antibodies is the most common diagnostic tool used to monitor M. hyopneumoniae infection. Both fluorescent antibody and enzyme-linked immunosorbent assay (ELISA) are commonly used assays. 2,9,10,12,14,16,20 Diagnosis by serology relies upon the response of the animal to the organism and thus can take 3 8 weeks to develop. Fluorescent techniques for the detection of antigen are compromised by crossreactivity with Mycoplasma hyorhinis and the nonpathogen Mycoplasma flocculare. 18 It also requires sacrificing the animal, and the sensitivity of the immunofluorescent assay is easily compromised if tissues are not handled properly. Recently, polymerase chain reaction (PCR)-based diagnostic tests for M. hyopneumoniae have been developed. Polymerase chain reaction has an inherent advantage over other diagnostic methods because it is ideally suited for detection of fastidious organisms such as Mycoplasma. Both single-stage tests 1,3,5,13,15 and nested set formats 6,7,22,23,25 have been developed. The objectives of these experiments were to enhance the detection threshold of our previous single-stage PCR diagnostic test, 3 compare its threshold with other available diagnostic PCR primer pairs, and assess sensitivity and specificity with a variety of sample sites from experimentally infected pigs. The results of this study indicate that nested PCR is sufficiently sensitive to detect the equivalent of 1 organism in the proportion 463

2 464 Kurth et al. of DNA sampled. This increased sensitivity, however, creates problems with contamination and false positives. Using brush samples from the trachea or upper bronchi or from the bronchial alveolar lavage (BAL) fluid enables the use of less sensitive single PCR pair techniques while maintaining the accuracy and reproducibility of the assay. Materials and methods Organisms and DNA preparation. Mycoplasma hyopneumoniae strain 232A, a derivative of M. hyopneumoniae strain 11, was used as the source of chromosomal DNA for positive controls in the PCR reactions. It was grown and maintained in Friis medium supplemented with 20% acidadjusted porcine serum and fresh yeast extract. 11 The chromosomal DNA was prepared from pelleted cells by a modified method described previously. 19 DNA amplification. Oligonucleotides were synthesized by standard methods using an automated DNA synthesizer. Two versions of the test were used in this study. For the comparison of primer pairs, the reaction contained 1.25 U Taq polymerase, a 25 l 2 MasterAmp E buffer, b 50 pmol each of primers TH132 and TH133, and 10 l of the target DNA. Polymerase chain reactions were performed in a final volume of 50 l. The reaction conditions were as follows: 4 min denaturation at 94 C followed by 30 cycles of denaturation at 94 C for 1 min, annealing at 49 C for 1 min, and extension at 72 C for 1 min. The reaction was then incubated at 72 C for 7 min to complete the extension reaction. For the inner primer pair reaction, the 50- l volume contained 1.25 U Qiagen Taq polymerase, c 1 Qiagen buffer, 1 Q solution, 4 mm MgCl 2 (2.5 mm additional), 5.5 pmol of each primer (Mhp3 and Mhp4), 2 nm deoxyribonucleoside- 5 -triphosphates, and 2 l of a 1:200 dilution of the firststage product. The reaction conditions were as follows: 2 min denaturation at 92 C followed by 30 cycles of denaturation at 92 C for 1 min, annealing at 56 C for 1 min, and extension at 72 C for 1 min. The reaction was then incubated at 72 C for 3 min to complete the extension reaction. A second version of our nested set was developed in order to include an internal control to check for amplifiable chromosomal DNA. The protocol was reoptimized with these changes: in both stage 1 and stage 2, the primers for detection of porcine 2-microglobulin were added at a concentration of 0.03 M and Taq was increased to 2 U per reaction. Magnesium ion concentration was increased to 40 mm in the second-stage reaction. Also, the dilution of stage 1 reaction was changed to 1:20. The cycle parameters for the PCR remained the same. A PTC-200 thermal cycler d was used for all reactions. The primer pairs and the sequence amplified for M. hyopneumoniae are shown in Fig. 1. The sequence for porcine 2-microglobulin can be found in GenBank (Accession No. L13854). For comparison with other published primers (Table 1), the protocol in each reference was followed with the following exceptions. Chromosomal DNA was prepared using the QiaAmp DNA Mini Kit c or Puregene DNA isolation kits. e Amplification was accomplished as specified in each reference with the addition of a 4-min denaturation cycle as a first step in testing the primers on BAL fluid. Additionally, in the Calsamiglia report, 7 the nucleotide and primer concentrations were obviously transposed, and this was corrected in our performance of the test. Amplified samples (5 10 l) were loaded and electrophoresed on a 1% or 1.8% agarose gel depending on the product size in tris-acetate EDTA (TAE) buffer. The gels were stained with ethidium bromide and viewed under ultraviolet (UV) illumination to assess the product. Animals and clinical specimens. Ten- to 12-day-old crossbred pigs were obtained from a commercial herd serologically negative for M. hyopneumoniae. At 5 wk of age, pigs were administered a tissue homogenate containing strain 232A (10 5 color-changing units/ml). Pigs were necropsied 28 days postinoculation. A portion of the lung with lesions consistent with M. hyopneumoniae infection was aseptically collected for M. hyopneumoniae isolation. Nasal and tracheobronchial samples were collected using cotton swabs and cytology brushes. f Lungs were lavaged with 50 ml of sterile phosphate buffered saline to obtain BAL fluid. Mycoplasma hyorhinis infected pigs were inoculated intranasally with color-forming units of strain SK76. Preparation of samples for PCR. DNA from clinical samples was isolated using the Qiagen QIAamp tissue kit c for lung tissues and BAL fluids. Puregene kits e were used for tracheobronchial brushes and swabs, nasal swabs, and some lung tissue and BALs. For both kits, the manufacturer s protocol was followed with the exception of the use of higher g forces (8,000 g) to pellet mycoplasmas. DNA concentrations were determined by fluorescence using the BioRad model TKO 100 Mini-Fluorometer g or by spectrophotometry using a Perkin-Elmer MBA 2000 spectrophotometer. h Results Sensitivity of primer pairs. A putative nested PCR outer primer set was identified by analyzing a M. hyopneumoniae specific chromosomal DNA sequence by computer analysis (Fig. 1). In a previous publication, this segment of the chromosome was tested by hybridization and demonstrated to not cross-react with porcine DNA or with any of the following organisms: M. hyorhinis, M. flocculare, Mycoplasma hyosynoviae, Mycoplasma arginini, Acholeplasma granularum, Acholeplasma axanthum, Acholeplasma laidlawii, Escherichia coli, Staphylococcus aureus, Bordetella bronchiseptica, Erysipelothrix rhusiopathiae, Haemophilus parasuis, Arcanobacterium pyogenes, and P. multocida. 3 This region is within a unique hypothetical gene of M. hyopneumoniae (Minion, unpublished data). The PCR test also failed to detect any of the organisms listed above. The reaction conditions needed to obtain maximum sensitivity were determined empirically for the inner primer pair by adjusting primer concentration, magnesium concentration, and annealing temperature. Colony-forming unit and color-changing unit measurements are less sensitive quantitative parameters of

3 Nested PCR for Mycoplasma hyopneumoniae 465 Figure 1. Chromosomal sequence and PCR primer pair location. The M. hyopneumoniae DNA sequence of the region amplified by the nested PCR primer pair described in this study is shown. Arrows indicate primer locations and direction of priming. Primer designations are also given. In the M. hyopneumoniae sequence recently completed (Minion, unpublished data), the inner fragment that constitutes the final product has been mapped to a unique hypothetical gene for which there is no GenBank match. M. hyopneumoniae than is PCR, and thus are not suitable for a comparison of sensitivity with different PCR assays. Therefore, comparisons were based on dilutions of purified M. hyopneumoniae strain 232A chromosomal DNA. A minimum of 2 different dilution series were tested with each primer pair. It was found that the sensitivity of the previously published PCR test 3 was amplified 1,000-fold with the inclusion of a nested set of primers. Also, the primer pairs developed in this laboratory detected fg of mycoplasmal chromosomal DNA (approximately 1 genome equivalent), which resulted in equal or increased sensitivity as compared with other nested set primer pairs. 6,22,25 It should be noted that in some cases it was not possible to directly assess whether the reported sensitivity was the same as that found in this report because the method of determining sensitivity was different (colorchanging units vs. DNA concentration). Results may also differ because of variability in PCR efficiency resulting from substrate and equipment differences. The PCR tests developed for a 1-stage reaction were predictably less sensitive than the nested set reactions, with values ranging from 10 pg to 100 fg in our hands (Table 1; Fig. 2). Assessment of efficacy in experimental pigs. In Table 2, panels A C represent the results of comparing different sample sites in 3 different animal studies with our nested PCR test. Lung tissues and nasal swabs from necropsy specimens were assayed by PCR in panel A of Table 2. In this study, only 65% of the lung tissues and 15% of nasal samples from experimentally infected animals were positive by PCR. In a second set of experimentally infected animals, other sample sites were examined (panel B). In these animals, ton-

4 Table 1. Comparison of the sensitivity of PCR primer pairs.* Reference Target site Primer sequences (5 3 ) This study unique hypothetical TH132 TH133 MHP3 MHP4 7 16S RNA Internal F Internal R 25 unknown Hp4 5 Hp6 5 TAAAACCCAACAAACCTAACT CAGATTCGCCAAATACAAAA AAGTTCATTCGCGCTAGCCC GCTCCTACTCCATATTGCCC ACTAGATAGGAAATGCTCTAG GTGGACTACCAGGGTATCT CGCTTTAGTACCGATATGGG-3 GCCATTCGCTTATATGGTGA-3 Reported sensitivity NA Observed sensitivity 80 CFU 1 fg bp repetitive sequence MHP950-1L AGGAACACCATCGCGATTTTTA 1 CFU 2.5 fg MHP950-1R MHP950-2L MHP950-2R ATAAAAATGGCATTCCTTTTCA CCCTTTGTCTTAATTTTTGCAA GCCGATTCTAGTACCCTAATCC 3 unknown sequence MHP3 MHP4 8 intergenic sequence FSP5 RSP5 5 unknown Forward HP1 Reverse HP S rrna Forward Reverse GenBank accession No. L microglobulin Forward Reverse AAGTTCATTCGCGCTAGCCC GCTCCTACTCCATATTGCCC GGGCCGATGAAACCTATTAAAATAGCT GCCGCGAAATTAAATATTTTTAATTGCATCCTG TTCAAATTATAACCTCGGTC AGCAAATTTAGTCTCTCTGC GAGCCTTCAAGCTTCACCAAGA TGTGTTAGTGACTTTTGCCACC GGTTCAGGTTTACTCACGCCAC CTTAACTATCTTGGGCTTATCG 1fg fg 1fg 1 10 pg 1 10 pg 50 pg 1 pg 500 fg 10 pg 5 CFUs 100 fg * Shown are the results of PCR reactions comparing the sensitivity of the respective assays. Method of comparison was described in Fig. 2. The sensitivity of the five nested set reactions was 0.5 to 2.5 fg. The sensitivity of the single stage reactions was 10 pg 100 fg. The target site column is an identification of the gene or ribosomal RNA sequence that the primers amplify in M. hyopneumoniae. Indicates a nested pair PCR test. 466 Kurth et al.

5 Nested PCR for Mycoplasma hyopneumoniae 467 Table 2. Comparison of specimen samples by nested PCR. Figure 2. Establishment of primer sensitivity. The figure shown is representative of the analysis. For each primer pair, 2 independent chromosomal DNA dilution series were analyzed on separate days. Numbers refer to the amount of M. hyopneumoniae chromosomal DNA in the reaction. For nested pair reactions, it is the amount of DNA template in the first reaction tube. Kurth, nested PCR primers developed in this study; Mattsson, single primer pair as described. 15 sillar swabs were not predictive of infection. Five of 6 samples from other sites in this experiment contained detectable levels of M. hyopneumoniae. To enhance the test and control for DNA loss or inhibitory substances in samples, a primer pair was included that detected porcine 2-microglobulin to show that DNA isolated from clinical samples was amplifiable. This required reoptimization of the concentrations of Taq polymerase and magnesium in the second-stage reaction. In a third animal experiment with the multiplex PCR, M. hyopneumoniae was consistently detected in tracheobronchial swabs or brushes and BAL fluids with 22 of 22 samples of culture-positive pigs positive by PCR (Table 2, panel C). A 2-microglobulin band was observed in all samples (Fig. 3). To demonstrate the specificity of the test, known negative samples were included in the study. An example of a negative result is also shown in Fig. 3. The M. hyopneumoniae positive control is shown at 456 bp, and the 2-microglobulin band for each of the negative samples is shown at 230 bp. Several previous studies have reported the detection Experiment* Panel A Panel B Panel C Panel D LT (15/23) TBS (5/6) BAL (22/22) BAL-C (0/6) Sample types NS (2/13) TBB (5/6) TBB (22/22) BAL-H (0/9) TS (0/6) BAL (5/6) * Data are given as number of positive reactions/number of samples tested by nested PCR. Panel A: PCR results for detection of M. hyopneumoniae from 25 mg of lung tissue (LT) or cotton-tipped nasal swab (NS). Panel B: Site comparison for optimal detection of experimentally infected pigs. TBB tracheobronchial brush; TBS tracheobronchial swab; TS tonsillar swab; BAL bronchial alveolar lavage fluid. Panel C: comparison of larger numbers of samples from experimentally infected pigs from TBB and BAL sites. Panel D: BAL-C, BAL fluids from known mycoplasma-negative pigs. BAL-H, BAL fluids from pigs infected only with M. hyorhinis. of M. hyopneumoniae in a high percentage of BAL fluids using a single-stage PCR. 4,5,8 In addition, 2 nested set protocols were published that also demonstrated high sensitivity with BAL fluids 25 and bronchial swabs. 6 To determine whether a single-stage PCR was sufficiently sensitive to detect M. hyopneumoniae in BAL samples, a comparative study was performed to test the inner pair primers of this report against inner pairs 6,25 and primers 8 published previously. This test used a set of BAL fluids from 22 experimentally infected pigs confirmed as culture positive for M. hyopneumoniae. The inner primers of the 3 nested sets in Table 1 were comparable in sensitivity to the single stage primers (Table 3). In all cases, the inner primer sets alone were able to detect M. hyopneumoniae in all the 22 positive BAL fluids. Discussion The study reported here found that tracheobronchial brushes and BAL fluids were the best sites to sample Figure 3. Example of nested set PCR reaction. A, tracheobronchial brush samples with the 2-microglobulin control for the presence of amplifiable DNA (same samples as in Table 2). Samples are from culture-positive animals. Outer lanes contain molecular weight markers. B, negative control samples, examples of a PCR reaction positive for 2-microglobulin but negative for M. hyopneumoniae. These samples are from 9 pigs experimentally infected with M. hyorhinis but culturally and serologically negative for M. hyopneumoniae. Six additional noninfected control pigs were tested as negative controls, but only one (lane 2) is shown. Outer lanes contain different molecular weight markers. The remaining lanes contain samples from the pigs experimentally infected with M. hyorhinis.

6 468 Kurth et al. Table 3. Comparison of efficacy of published primer pairs.* Hp4/6 intf/intr FSp36/RSp36 Mhp3/4 22/22 22/22 22/22 22/22 * The inner set from three nested set reactions were compared with a single-stage reaction listed in Table 1 using 22 BAL samples from experimentally infected pigs. Data are given as number of positive reactions/number of samples tested. PCR reaction and cycling conditions were described in the original reference. Hp4/Hp6, Verdin primers 25 ; intf/intr, Calsamiglia primers 7 ; FSp36/RSp36, Caron primers 8 ; and MHP3/4, Artiushin primers 3. for detection of M. hyopneumoniae with a sensitivity of 95% 100%. Lung tissues and nasal swabs were not reliable sites for sampling for M. hyopneumoniae. The sample from lung lesions was small (25 mg), so in many cases this subsection of the lesion may not have contained organisms. It is known that M. hyopneumoniae binds to cilia and is found in great abundance in the upper respiratory tract in contact with the ciliated epithelium. 18 Few cilia are found in the lungs where lesions occur, and the lesion pathology may actually be because of secondary immunopathology. An important concern in using a nested PCR is environmental contamination caused by the high sensitivity of the assay. Usual precautions of aerosol protected tips, dedicated pipettes, and separate clean and nucleic acid areas are required. It is also important to appropriately UV-irradiate work surfaces and make all solutions in a clean laboratory, i.e., one that has no routine mycoplasma culturing or laboratory work. Even with these laboratory precautions, results of a nested set PCR are valid only if attention is paid to preventing aerosol and sample cross-contamination in the necropsy room. Stark et al. 22 could detect M. hyopneumoniae in air samples from pig houses using a nested set PCR, which was confirmed in this study by exposing swabs to the air in the mycoplasma laboratory (data not shown). False positives can be eliminated only through careful adherence to prescribed procedures. A single-stage PCR is not as prone to environmental contamination because of the fewer cycles involved and may be a more reliable indicator of infection with the appropriate samples. The results of the study reported here demonstrate that the nested pair PCR can detect single organisms. The sensitivity seen with this assay may be helpful in testing new animals before their introduction into a M. hyopneumoniae free herd and to assess the status of animals before experimentation. Care must be taken to avoid contamination in M. hyopneumoniae positive environments. The most reliable sample sites determined for experimentally infected pigs were BAL fluids and tracheobronchial brushes. With these samples, a nested PCR was not necessary because sufficient numbers of organisms were present for the single-stage reaction. If BAL fluids are sampled, a single-stage PCR such as that described here is sufficiently sensitive to detect all positive animals in a herd. If other samples such as nasal swabs are examined, even nested PCR tests sometimes fail to detect organisms in positive animals. If the environment is sampled, a nested PCR test is essential, although special care must be taken so as to not contaminate the samples. Similar results are expected in naturally infected animals even though the infectious dose is much lower and the pigs often harbor additional pathogens. Sources and manufacturers a. Sigma Chemical Co., St. Louis, MO, or Gibco BRL, Gaithersburg, MD. b. EpiCentre Technology, Inc., Madison, WI. c. Qiagen, Inc., Valencia, CA. d. M. J. Research, Inc., Watertown, ME. e. Gentra Systems, Minneapolis, MN. f. Medical Packaging Corp., Camarillo, CA. g. Bio-Rad Laboratories, Richmond, CA. h. Perkin-Elmer Corp. Norwalk, CT. References 1. Abiven P, Blanchard B, Saillard C, et al.: 1992, A specific DNA probe for detecting Mycoplasma hyopneumoniae in experimentally infected piglets. Mol Cell Probe 6: Amanfu W, Weng CN, Ross RF, Barnes HJ: 1984, Diagnosis of mycoplasmal pneumonia of swine: sequential study by direct immunofluorescence. Am J Vet Res 45: Artiushin S, Stipkovits L, Minion FC: 1993, Development of polymerase chain reaction primers to detect Mycoplasma hyopneumoniae. Mol Cell Probes 7: Baumeister AK, Runge M, Ganter M, et al.: 1998, Detection of Mycoplasma hyopneumoniae in bronchoalveolar lavage fluids of pigs by PCR. J Clin Microbiol 36: Blanchard B, Kobisch M, Bove JM, Saillard C: 1996, Polymerase chain reaction for Mycoplasma hyopneumoniae detection in tracheobronchiolar washings from pigs. Mol Cell Probe 10: Calsamiglia M, Collins JE, Pijoan C: 2000, Correlation between the presence of enzootic pneumonia lesions and detection of Mycoplasma hyopneumoniae in bronchial swabs by PCR. Vet Microbiol 76: Calsamiglia M, Pijoan C, Trigo A: 1999, Application of a nested polymerase chain reaction assay to detect Mycoplasma hyopneumoniae from nasal swabs. J Vet Diagn Invest 11: Caron J, Ouardani M, Dea S: 2000, Diagnosis and differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis infections in pigs by PCR amplification of the p36 and p46 genes. J Clin Microbiol 38: Djordjevic SP, Eamens GJ, Romalis LF, Saunders MM: 1994, An improved enzyme linked immunosorbent assay (ELISA) for the detection of porcine serum antibodies against Mycoplasma hyopneumoniae. Vet Microbiol 39: Doster AR, Lin BC: 1988, Identification of Mycoplasma hyopneumoniae in formalin-fixed porcine lung, using an indirect immunoperoxidase method. Am J Vet Res 49: Freundt EA: 1983, Culture media for classic mycoplasmas. In: Methods in mycoplasmology, vol. 1, Mycoplasma characteriza-

7 Nested PCR for Mycoplasma hyopneumoniae 469 tion, ed. Razin S, Tully JG, pp Academic Press, New York, NY. 12. Futo S, Seto Y, Okada M, et al.: 1995, Recombinant 46-kilodalton surface antigen (P46) of Mycoplasma hyopneumoniae expressed in Escherichia coli can be used for early specific diagnosis of mycoplasmal pneumonia of swine by enzyme-linked immunosorbent assay. J Clin Microbiol 33: Harasawa R, Koshimizu K, Takeda O, et al.: 1991, Detection of Mycoplasma hyopneumoniae DNA by the polymerase chain reaction. Mol Cell Probes 5: Le Potier MF, Abiven P, Kobisch M, et al.: 1994, A blocking ELISA using a monoclonal antibody for the serological detection of Mycoplasma hyopneumoniae. Res Vet Sci 56: Mattsson JG, Bergstrom K, Wallgren P, Johansson KE: 1995, Detection of Mycoplasma hyopneumoniae in nose swabs from pigs by in vitro amplification of the 16S rrna gene. J Clin Microbiol 33: Mori Y, Hamaoka T, Sato S: 1987, Use of monoclonal antibody in an enzyme-linked immunosorbent assay (ELISA) for the detection of antibodies against Mycoplasma hyopneumoniae. Isr J Med Sci 23: Ross RF: 1986, Mycoplasmal disease. In: Diseases of swine, ed. Leman AD, Straw B, Block RD, et al., 6th ed., pp Iowa State University Press, Ames, IA. 18. Ross RF: 1992, Mycoplasmal disease. In: Diseases of swine, ed. Leman AD, Straw BE, Mengeling WL, et al., pp Iowa State University Press, Ames, IA. 19. Sambrook J, Fritsch EF, Maniatis T: 1989, Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 20. Schuller W, Lehmkuhl HD, Switzer WP: 1976, A fluorescent antibody technique for identification of Mycoplasma hyopenumoniae colonies. Am J Vet Res 37: Sitjar M, Noyes EP, Simon X, Pijoan C: 1996, Relationships among seroconversion to Mycoplasma hyopenumoniae, lung lesions, and production parameters in pigs. Swine Health Prod 4: Stark KDC, Nicolet J, Frey J: 1998, Detection of Mycoplasma hyopneumoniae by air sampling with a nested PCR. Applied Environ Microbiol 64: Stemke GW: 1997, Gene amplification (PCR) to detect and differentiate mycoplasmas in porcine mycoplasmal pneumonia. Lett Appl Microbiol 25: Thacker EL, Halbur PG, Ross RF, et al.: 1999, Mycoplasma hyopneumoniae potentiation of porcine reproductive and respiratory syndrome virus-induced pneumonia. J Clin Microbiol 37: Verdin E, Saillard C, Labbe A, et al.: 2000, A nested PCR assay for the detection of Mycoplasma hyopneumoniae in tracheobroncholar washings from pigs. Vet Microbiol 15:31 40.