CRISPR-Cas - introduction. John van der Oost
|
|
- Kerry Manning
- 6 years ago
- Views:
Transcription
1 CRISPR-Cas - introduction John van der Oost
2 CRISPR-Cas 2 classes cas operon leader CRISPR CRISPR clustered regularly interspaced palindromic repeats Cas CRISPR-associated genes & proteins present in genomes of 40% of bacteria and 85% of archaea Jansen (2002) Mol Microbiol, Makarova (2015) Nat Rev Microbiol
3 CRISPR-Cas 2 classes Class 1 cas operon leader CRISPR Cas3 Cascade-like Cas1/Cas2 crrna Class 2 cas operon leader CRISPR Cas9-like Cas1/Cas2 crrna Jansen (2002) Mol Microbiol, Makarova (2015) Nat Rev Microbiol
4 CRISPR-Cas mechanism Spacer acquisition Guide expression many CRISPR spacers are homologous to viruses or plasmids experimental evidence: adaptive & heritable immunity Target interference Mojica (2005), Pourcel (2005), Bolotin (2005), Barrangou (2007) Science
5 CRISPR-Cas class 1 Class 1 cas operon leader CRISPR Cascade-like Cas1/Cas2 crrna first insights in molecular basis of CRISPR interference immunity control (no phage) sensitivity Natural defense & Engineering - maturation pre-crrna > crrna - RNP complex (Cascade/crRNA) - DNA nuclease (Cas3) - RNA-guide DNA interference - crrna design & spec. targeting Brouns et al. (2008) Science
6 CRISPR-Cas mechanism 3 stages Spacer acquisition Guide expression Target interference Van der Oost (2014) Nat Rev Microbiol
7 CRISPR-Cas mechanism auto-immunity? Van der Oost (2014) Nat Rev Microbiol
8 CRISPR-Cas self / non-self discrimination self non-self Van der Oost (2014) Nat Rev Microbiol
9 CRISPR-Cas self / non-self discrimination Spacer acquisition Target interference non-self Target interference
10 CRISPR-Cas self / non-self discrimination Seed Protospacer Adjacent Motif (PAM) Target interference Jore et al. (2011) NSMB, Semanova et al. (2011) PNAS, Westra et al. (2012) PLoS Gen.
11 E.coli Cascade & Cas3 target interference Richard van der Oost ( Jackson (2014) Science, Gong (2015) PNAS
12 CRISPR Application genome editing Fusion of a Nuclease domain (FokI) with DNA-binding domain (ZF, TALE Cascade)
13 CRISPR Application genome editing Fusion of a Nuclease domain (FokI) with DNA-binding domain (ZF, TALE, Cascade) Brouns & Van der Oost (2011) patent
14 CRISPR-Cas 2 classes Class 1 cas operon leader CRISPR Cascade-like Cas1/Cas2 crrna Class 2 cas operon leader CRISPR Cas9-like Cas1/Cas2 crrna Jansen (2002) Mol Microbiol, Makarova (2015) Nat Rev Microbiol
15 Class 2 / Type II Cas9 Type II unique features single subunit (Cas9) two DNase domains PAM at 3 side crrna & tracrrna RNase-III (non-cas) dsdna break, blunt ends Garneau (2010), Deltcheva (2011), Jinek (2012), Gasiunas (2012)
16 Class 2 / Type II Cas9 Cong (2013) Science, Mali (2013) Science, Jinek (2013) elife, Kim (2013) Nat Biotech
17 CRISPR Application genome editing Hsu & Zhang (2014) Cell
18 Class 2 Cas9 & Cpf1 5 5 PAM Type II Cas9 Zetsche (2015) Cell, Mohanraju et al. (2016) Science
19 Class 2 Cas9 & Cpf1 5 5 PAM Type II Cas9 5 PAM Type V Cpf1 5 Zetsche (2015) Cell, Mohanraju et al. (2016) Science
20 Class 2 Cas9 & Cpf1 AsCpf1 LbCpf1 SpCas9 comparable efficiency of Cas9 and Cpf1 to generate knockouts in human cells Zetsche (2015) Cell, Mohanraju et al. (2016) Science
21 Genome editing systems Peptide-guided: Restriction & Homing enzymes Peptide-guided / engineered: TALEN & ZFN nucleases Oligo DNA/RNA-guided: Argonaute & CRISPR-Cas beat their swords into ploughshares
22 Collaborators Wageningen Stan Brouns* Matthijs Jore* Edze Westra* Magnus Lundgren* Daan Swarts* Raymond Staals Yifan Zhu Jorrit Hegge Prarthana Mohanraju Wen Wu Sjoerd Creutzburg Utrecht Albert Heck Rotterdam Rogier Louwen Bethesda Kira Makarova Eugene Koonin Boston Feng Zhang New York Dinshaw Patel Beijing Yanli Wang Berkeley Jennifer Doudna Bozeman Blake Wiedenheft
23
24 CRISPR Application genome editing AsCpf1 LbCpf1 SpCas9 comparable efficiency of Cas9 and Cpf1 to generate knockouts Makarova (2015) Nat Rev Microbiol., Zetsche et al. (2015) Cell
25 Class 1 & 2 - summary 5 PAM 5 Type I Cascade + Cas3 Class 1 5 Type III Csm / Cmr PAM Type II Cas9 Class 2 5 PAM Type V Cpf1 5
26 CRISPR-Cas CRISPR-Cas is more than Cas9 Cas9
27 CRISPR-Cas CRISPR-Cas is an anti-virus system of bacteria and archaea... Cas9 - operon... and there is a huge diversity of CRISPR-Cas systems
28 CRISPR-Cas diversity Class 1 E. coli Cascade & Cas3 Makarova (2015) Nat Rev Microbiol
29 CRISPR-Cas diversity Class 2 Streptococcus Cas9 Makarova (2015) Nat Rev Microbiol Francisella Cpf1
30 Makarova (2015) Nat Rev Microbiol CRISPR-Cas diversity
31 CRISPR Application (3) genome editing guided RNP complex Richard van der Oost ( Brouns & Van der Oost (unpubl.)
32 CRISPR-Cas self / non-self discrimination Scanning for PAM Seed nucleation Complete R-loop formation Interference 5 3 seed PAM protospacer Jore et al. (2011) NSMB, Semanova et al. (2011) PNAS, Westra et al. (2012) PLoS Gen.
33 CRISPR-Cas diversity 2 classes???? Mohanraju, Zhang, Koonin, Van der Oost (2016) Science
34 CRISPR-Cas diversity Class 1 Cascade Class 2 Cas9 Mohanraju, Zhang, Koonin, Van der Oost (2016) Science
35 CRISPR-Cas diversity???? Class 2 Cas effector proteins (Cas9 / Cpf1) are multi-functional Mohanraju, Zhang, Koonin, Van der Oost (2016) submitted
36 Class 2 Cas9 & Cpf1? in silico prediction of structural differences Makarova (2015) Nat Rev Microbiol.
37 Class 2 Cas9 & Cpf1 Francisella novicida Cas9 5 side 3 side Francisella novicida Cpf1 5 side 3 side in silico prediction of functional differences experimental confirmation Makarova (2015) Nat Rev Microbiol., Zetsche et al. (2015) Cell
38 Class 2 Cas9 & Cpf1 unlike Cas9, Cpf1 can process its own guides this may facilitate multiplex knockouts by Cpf1 with CRISPR array efficiency of homologous recombination is under investigation Makarova (2015) Nat Rev Microbiol., Zetsche & Mohanraju (2016) unpubl.
39 CRISPR Application (1) Flu Shot Protect good bacteria from bad viruses control (no phage) engineering of anti-virus immunity of E. coli BL21 immunity sensitivity requires: - Cas3 - nuclease - Cascade - complex - (design) anti-virus crrna Brouns et al. (2008) Science
40 CRISPR Application (2) Phage therapy 2.0 Engineer good viruses (with Cas9) to target bad bacteria Bacteriophage-based delivery of Cas9 that specifically targets virulence genes, and as such only kills virulent bacteria Bikard et al. (2014) Nat Biotech
41 CRISPR Application (3) genome editing Hsu & Zhang (2014) Cell
42 CRISPR-Cas mechanism adaptive immunity Van der Oost (2014) Nat Rev Microbiol
43 virus infection in prokaryotes DNA RNA protein
44 prokaryotic defence systems Restriction Enzymes Prokaryotic Argonautes CRISPR-Cas systems Van der Oost et al. (2014) Nat. Rev. Microbiol., Swarts et al. (2014) NSMB
45 RNA-guided DNA interference by CRISPR-Cas from exploration to exploitation CRISPR-Cas discovery & mechanism Cas9-like complexes & applications
46 CRISPR-Cas system CRISPR = clustered regularly interspaced palindromic repeats Cas-CRISPR-associated genes & proteins present in genomes of 40% of bacteria and 85% of archaea cas operon leader CRISPR Makarova (2015) Nat Rev Microbiol
47 RNA-guided DNA interference by CRISPR-Cas from exploration to exploitation CRISPR-Cas discovery & mechanism Cas9-like complexes & applications
48 CRISPR-Cas9 Type II unique features single subunit (Cas9) crrna & tracrrna PAM at 3 side two DNase domains dsdna break, blunt ends Jinek et al. (2014) Science, Nishimasu et al. (2014) Cell, Anders et al. (2014) Nature
49 CRISPR-Cpf1 5 5 PAM Type II Cas9 Class 2 5 PAM Type V Cpf1 5 va (2015) Nat Rev Microbiol., Zhang et al. (2015) Cell, Charpentier et al (2016) Nature
50 CRISPR Application genome editing Hsu & Zhang (2014) Cell
51 RNAi and DNAi systems - applications Bacterial Defence systems Restriction Enzymes Prokaryotic Argonautes CRISPR-Cas systems beat their swords into ploughshares
52 Collaborators Wageningen Prarthana Mohanraju Yifan Zhu Wen Wu Jorrit Hegge Raymond Staals* Daan Swarts* Matthijs Jore* Edze Westra* Stan Brouns* Beijing Yanli Wang Bethesda Kira Makarova Eugene Koonin Boston Bernd Zetsche Feng Zhang Bozeman Blake Wiedenheft Rotterdam Hans van Leeuwen Irene Mathijssen Utrecht Niels Geijsen Berkeley David Taylor Jennifer Doudna
53 CRISPR Application genome editing multiplex knockouts by Cpf1 with CRISPR array efficiency of homologous recombination is under investigation Makarova (2015) Nat Rev Microbiol., Zetsche & Mohanraju (2016) submitted
54 CRISPR-Cas diversity???? Class 2 Cas effector proteins (Cas9 / Cpf1) are multi-functional Mohanraju, Zhang, Koonin, Van der Oost (2016) submitted
55 CRISPR Application (1) Flu Shot Protect good bacteria from bad viruses control (no phage) engineering of anti-virus immunity of E. coli BL21 immunity sensitivity requires: - Cas3 - nuclease - Cascade - complex - (design) anti-virus crrna Brouns et al. (2008) Science
56 CRISPR Application (2) Phage therapy 2.0 Engineer good viruses (with Cas9) to target bad bacteria Bacteriophage-based delivery of Cas9 that specifically targets virulence genes, and as such only kills virulent bacteria Bikard et al. (2014) Nat Biotech
57 CRISPR-Cas diversity Class 1 Cascade Class 2 Cas9 Mohanraju, Zhang, Koonin, Van der Oost (2016) submitted
58 RNA-guided DNA interference by CRISPR-Cas from exploration to exploitation CRISPR-Cas discovery & mechanism class 1 Cascade-like complexes class 2 Cas9-like complexes applications
59 CRISPR Application (3) genome editing Hsu & Zhang (2014) Cell
60 Class 2 / Type V Cpf1 Type II unique features single subunit (Cas9) two DNase domains PAM at 3 side crrna & tracrrna? RNase-III (non-cas) dsdna break, blunt ends Type V unique features single subunit (Cpf1) PAM at 5 side RNase? crrna, no tracrrna dsdna break, sticky ends Makarova (2015) Nat Rev Microbiol., Zetsche et al. (2015) Cell
61 Class 2 / Type V Cpf1 Type II unique features single subunit (Cas9) two DNase domains PAM at 3 side crrna & tracrrna? RNase-III (non-cas) dsdna break, blunt ends Type V unique features single subunit (Cpf1) single DNase domain (RuvC) PAM at 5 side RNase? crrna, no tracrrna dsdna break, sticky ends Makarova (2015) Nat Rev Microbiol., Zetsche et al. (2015) Cell
62 Class 2 / Type V Cpf1 Type II unique features Francisella novicida Cas9 single subunit (Cas9) two DNase domains 5 side 3 side PAM at 3 side crrna & tracrrna RNase-III (non-cas) in silico prediction dsdna break, blunt ends experimental confirmation Francisella novicida Cpf1 Type V unique features single subunit (Cpf1) single DNase domain (RuvC) PAM at 5 side 5 side 3 side Makarova (2015) Nat Rev Microbiol., Zetsche et al. (2015) Cell
63 Class 2 / Type V Cpf1 Type II unique features single subunit (Cas9) functional expression of two DNase domains cpf1 locus (variants) in E.coli: PAM at 3 side RNA-guided DNA interference crrna & tracrrna RNase-III (non-cas) dsdna break, blunt ends Type V unique features single subunit (Cpf1) single DNase domain (RuvC) PAM at 5 side crrna, no tracrrna Makarova (2015) Nat Rev Microbiol., Zetsche et al. (2015) Cell
64 Class 2 / Type V Cpf1 Type II unique features single subunit (Cas9) two DNase domains PAM at 3 side crrna & tracrrna RNase-III (non-cas) dsdna break, blunt ends Type V unique features single subunit (Cpf1) single DNase domain (RuvC) PAM at 5 side crrna, no tracrrna no RNase, cleavage by Cpf1 Makarova (2015) Nat Rev Microbiol., Zetsche & Mohanraju (2016) submitted
65 Class 2 / Type V Cpf1 Type II unique features single subunit (Cas9) two DNase domains PAM at 3 side crrna & tracrrna RNase-III (non-cas) dsdna break, blunt ends Type V unique features single subunit (Cpf1) single DNase domain (RuvC) PAM at 5 side crrna, no tracrrna no RNase, cleavage by Cpf1 dsdna break, sticky ends Makarova (2015) Nat Rev Microbiol., Zetsche et al. (2015) Cell
66 CRISPR-Cas system - discovery GAGTTCCCCGCGCCAGCGGGGATAAACCGCTTTCGCAGACGCGCGGCGA TACGCTCACGCAGAGTTCCCCGCGCCAGCGGGGATAAACCGCAGCCGAA GCCAAAGGTGATGCCGAACACGCTGAGTTCCCCGCGCCAGCGGGGATAA ACCGGGCTCCCTGTCGGTTGTAATTGATAATGTTGAGAGTTCCCCGCGC CAGCGGGGATAAACCGTTTGGATCGGGTCTGGAATTTCTGAGCGGTCGC GAGTTCCCCGCGCCAGCGGGGATAAACCGCGAATCGCGCATACCCTGCG CGTCGCCGCCTGCGAGTTCCCCGCGCCAGCGGGGATAAACCGTCAGCTT TATAAATCCGGAGATACGGAAACTAGAGTTCCCCGCGCCAGCGGGGATA CRISPR clustered regularly interspaced palindromic repeats Cas CRISPR-associated genes & proteins present in genomes of 40% of bacteria and 85% of archaea Oshino (1987), She (2001), Jansen (2002)
67 CRISPR-Cas system - discovery GAGTTCCCCGCGCCAGCGGGGATAAACCGCTTTCGCAGACGCGCGGCGA TACGCTCACGCAGAGTTCCCCGCGCCAGCGGGGATAAACCGCAGCCGAA GCCAAAGGTGATGCCGAACACGCTGAGTTCCCCGCGCCAGCGGGGATAA ACCGGGCTCCCTGTCGGTTGTAATTGATAATGTTGAGAGTTCCCCGCGC CAGCGGGGATAAACCGTTTGGATCGGGTCTGGAATTTCTGAGCGGTCGC GAGTTCCCCGCGCCAGCGGGGATAAACCGCGAATCGCGCATACCCTGCG CGTCGCCGCCTGCGAGTTCCCCGCGCCAGCGGGGATAAACCGTCAGCTT TATAAATCCGGAGATACGGAAACTAGAGTTCCCCGCGCCAGCGGGGATA CRISPR clustered regularly interspaced palindromic repeats Cas CRISPR-associated genes & proteins present in genomes of 40% of bacteria and 85% of archaea Oshino (1987), She (2001)
68 CRISPR-Cas system - discovery GAGTTCCCCGCGCCAGCGGGGATAAACCGCTTTCGCAGACGCGCGGCGA TACGCTCACGCAGAGTTCCCCGCGCCAGCGGGGATAAACCGCAGCCGAA GCCAAAGGTGATGCCGAACACGCTGAGTTCCCCGCGCCAGCGGGGATAA ACCGGGCTCCCTGTCGGTTGTAATTGATAATGTTGAGAGTTCCCCGCGC CAGCGGGGATAAACCGTTTGGATCGGGTCTGGAATTTCTGAGCGGTCGC GAGTTCCCCGCGCCAGCGGGGATAAACCGCGAATCGCGCATACCCTGCG CGTCGCCGCCTGCGAGTTCCCCGCGCCAGCGGGGATAAACCGTCAGCTT TATAAATCCGGAGATACGGAAACTAGAGTTCCCCGCGCCAGCGGGGATA CRISPR clustered regularly interspaced palindromic repeats Cas CRISPR-associated genes & proteins present in genomes of 40% of bacteria and 85% of archaea Oshino (1987), She (2001), Jansen (2002)
69 CRISPR-Cas system adaptive immunity GAGTTCCCCGCGCCAGCGGGGATAAACCGCTTTCGCAGACGCGCGGCGA TACGCTCACGCAGAGTTCCCCGCGCCAGCGGGGATAAACCGCAGCCGAA GCCAAAGGTGATGCCGAACACGCTGAGTTCCCCGCGCCAGCGGGGATAA ACCGGGCTCCCTGTCGGTTGTAATTGATAATGTTGAGAGTTCCCCGCGC CAGCGGGGATAAACCGTTTGGATCGGGTCTGGAATTTCTGAGCGGTCGC GAGTTCCCCGCGCCAGCGGGGATAAACCGCGAATCGCGCATACCCTGCG CGTCGCCGCCTGCGAGTTCCCCGCGCCAGCGGGGATAAACCGTCAGCTT TATAAATCCGGAGATACGGAAACTAGAGTTCCCCGCGCCAGCGGGGATA many CRISPR spacers are homologous to viruses or plasmids experimental evidence: adaptive & heritable immunity huge diversity of CRISPR-Cas systems Mojica (2005), Pourcel (2005), Bolotin (2005), Barrangou (2007), Makarova (2006)
70 CRISPR-Cas self / non-self discrimination protospacer Spacer acquisition fragmentation PAM screen integration Cas2 Guide expression Cas1 Cas1 Target interference Protospacer Adjacent Motif (PAM) Swarts (2012) PLoS One, Arslan (2014) NAR, Nuňez (2015) Nature, Wang (2015) Cell
71 Class 1 / Type I target interference Class 1 leader Cas3 Cascade Cas1/Cas2 crrna Cascade and Cas3 required for crrna-guided DNA interference crrna guide processing by Cas6 ribonuclease subunit of Cascade Functional design CRISPR allows for directed targeting Brouns & Jore (2008) Science
72 CRISPR-Cas diversity Mohanraju, Zhang, Koonin, Van der Oost (2016) submitted
73 Class 2 / Type V Cpf1 Francisella novicida Cas9 5 side 3 side Francisella novicida Cpf1 5 side 3 side BLAST search with CRISPR spacers as query hits of prophages in related strains Type II unique features single subunit (Cas9) two DNase domains PAM at 3 side crrna & tracrrna RNase-III (non-cas) dsdna break, blunt ends Type V unique features single subunit (Cpf1) single DNase domain (RuvC) PAM at 5 side - prediction RNase? crrna, no tracrrna dsdna break, sticky ends Makarova (2015) Nat Rev Microbiol., Zetsche et al. (2015) Cell
74 CRISPR Application (3) genome editing guided complex (Cas9, Cascade, Ago) with nuclease domains (FokI) Richard van der Oost ( Brouns & Van der Oost (unpubl.)
75 Class 1 / Type I target interference Class 1 leader Cas3 Cascade Cas1/Cas2 crrna Cascade and Cas3 required for crrna-guided DNA interference crrna guide processing by Cas6 ribonuclease subunit of Cascade Functional design CRISPR allows for directed targeting Brouns & Jore (2008) Science
76 Class 1 / Type I target interference Class 1 leader Cas3 Cascade Cas1/Cas2 crrna Jore (2011) NSMB, Wiedenheft (2011) Nature, Hochstrasser (2014) PNAS
77 CRISPR-Cas diversity Class 2 Cas effector proteins (Cas9 / Cpf1) are multi-functional
78 anti-virus systems in prokaryotes established mechanisms inhibition of adsorption (Omp) DNA RNA protein inhibition of DNA injection (Sie) degradation of DNA (R/M) abortive infection systems (T/AT) guided interference systems CRISPR-Cas Argonaute (pago) Van der Oost et al. (2014) Nat. Rev. Microbiol., Swarts et al. (2014) NSMB
79 CRISPR Application (3) genome editing Cpf1 as alternative for Cas9 : genome editing 2.0
80 RNAi and DNAi systems - applications guided complex of inactive Cas9 (dcas9) with nuclease domains (FokI) Guilinger (2014)
81 CRISPR-Cas9 applications Hsu & Zhang (2014) Cell
82 CRISPR-Cas / Type I Cascade & Cas3 Hochstrasser & Doudna (2014) PNAS Gong et al. (2014) PNAS
83 RNAi and DNAi systems - applications Cong et al. (2013) Science, Mali et al. (2013) Science, Van der Oost (2013) Science
84 Class 1 / Type I spacer acquisition cas operon CRISPR leader Cas3 Cascade Cas1/Cas2 crrna Swarts (2012) PLoS One, Arslan (2014) NAR, Nuňez (2015) Nature, Wang (2015) Cell
85 Class 1 / Type I target interference cas operon CRISPR leader Cas3 Cascade Cas1/Cas2 crrna Blosser (2015) Mol Cell, Rutkauskas (2015) NAR, Redding (2015) Cell
CRISPR cas : Presented By: Pooya Rashvand Advised By: Dr. M.Aslanimehr
Journal Club & MSc Seminar CRISPR cas : Presented By: Pooya Rashvand Advised By: Dr. M.Aslanimehr CRISPR - cas : A New tool for Genetic Manipulations from Bacterial Immunity Systems Viral SS DNA RNA Guide
More informationCRISPR: hot, hot, hot
CRISPR: hot, hot, hot 166 CRISPR is the latest technique for genome engineering and is generating tons of excitement due to its versatility, high specificity, and ease of use. CRISPR stands for clustered
More informationIntroduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design
Introduction and History of Genome Modification Adam Clore, PhD Director, Synthetic Biology Design Early Non-site Directed Genome Modification Homologous recombination in yeast TARGET GENE 5 Arm URA3 3
More informationCOMPUTATIONAL APPROACHES FOR DISCOVERY OF NOVEL CRISPR-Cas SYSTEMS. Doctoral Thesis SERGEY SHMAKOV DOCTORAL PROGRAM IN LIFE SCIENCES
Skolkovo Institute of Science and Technology COMPUTATIONAL APPROACHES FOR DISCOVERY OF NOVEL CRISPR-Cas SYSTEMS Doctoral Thesis by SERGEY SHMAKOV DOCTORAL PROGRAM IN LIFE SCIENCES Supervisor Professor
More informationBart Williams, PhD Van Andel Research Center
A History of Genome Editing in the Laboratory Implications for Translational Applications Bart Williams, PhD Van Andel Research Center Introduction by Matthew Denenberg, MD DeVos Childrens Hospital Disclosures:
More informationResearch Article SSFinder: High Throughput CRISPR-Cas Target Sites Prediction Tool
BioMed, Article ID 742482, 4 pages http://dx.doi.org/10.1155/2014/742482 Research Article SSFinder: High Throughput CRISPR-Cas Target Sites Prediction Tool Santosh Kumar Upadhyay and Shailesh Sharma National
More informationPotential of Genome Editing Tools in Agriculture, Preventive Health & Diseases - Current & Future
Potential of Genome Editing Tools in Agriculture, Preventive Health & Diseases - Current & Future Meng How TAN Email: mh.tan@ntu.edu.sg or tanmh@gis.a-star.edu.sg 23 April 2018 The Bio-Revolution Reading
More informationGene edi'ng with CRISPR
Gene edi'ng with CRISPR What is CRISPR and why is it important? Background Prac'cal example (DIY CRISPR kit) CRISPR CRISPR = Clustered Regularly-Interspaced Short Palindromic Repeats Bacterial defense
More informationNEXT GENERATION GENOME EDITING TECHNOLOGIES
NEXT GENERATION GENOME EDITING TECHNOLOGIES Author Mr. Ravi Shankar & Ms. Shifali Pandey ABSTRACT Gene editing took a new turn with the discovery of CRISPR and its variant CAS9, but along with it came
More informationCRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing
CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing Fei Ann Ran Broad Institute Cambridge, Massachusetts ran@fas.harvard.edu I will provide some background on the CRISPR/Cas9 technology,
More informationThe Development and Application of the CRISPR/CAS System as a Powerful New Tool for Genome Editing: A CASe Study. Zoe Dubrow.
The Development and Application of the CRISPR/CAS System as a Powerful New Tool for Genome Editing: A CASe Study Zoe Dubrow Biochemistry 158 1. Introduction Only a hundred and fifty years have passed since
More informationCRISPR/Cas9 From Yoghurt to Designer Babies. Source: nextbigfuture.com
CRISPR/Cas9 From Yoghurt to Designer Babies Source: nextbigfuture.com OBJECTIVES 1. Relate the functioning of bacterial CRISPR/Cas systems to acquired immunity 2. Describe how CRISPR/Cas9 cuts DNA 3. Explain
More informationDevelopment and Applications of CRISPR-Cas9 for Genome Engineering
Leading Edge Review Development and Applications of CRISPR-Cas9 for Genome Engineering Patrick D. Hsu, 1,2,3 Eric S. Lander, 1 and Feng Zhang 1,2, * 1 Broad Institute of MIT and Harvard, 7 Cambridge Center,
More informationCRISPR-mediated antiviral defence in prokaryotes
CRISPR-mediated antiviral defence in prokaryotes Matthijs M. Jore Thesis committee Thesis supervisor Prof. Dr. John van der Oost Personal Chair at the Laboratory of Microbiology Wageningen University Thesis
More informationUser Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption
User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)
More informationTECHNICAL BULLETIN. FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli
FnCas9 Protein FnCas9 - NLS from Francisella novicida, expressed in Escherichia coli Catalog Number FNCAS9PROT Storage Temperature 20 C TECHNICAL BULLETIN Product Description FnCas9 protein is a recombinant
More informationUniversal genome cutters: from selfish genetic elements to antivirus defence and genome editing tools
Universal genome cutters: from selfish genetic elements to antivirus defence and genome editing tools Eugene V. Koonin (National Library of Medicine, USA) Over the last 3 years, the new generation of genome
More informationCRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationCRISPRseek Workshop Design of target-specific guide RNAs in CRISPR-Cas9 genome-editing systems
April 2008 CRISPRseek Workshop Design of target-specific guide RNAs in CRISPR-Cas9 genome-editing systems Lihua Julie Zhu August 1st 2014 Outline Background and Motives CRISPRseek Functionality Dependency
More informationAlternative CRISPR system could improve genome editing
Alternative CRISPR system could improve genome editing Smaller enzyme may make process simpler and more exact. Heidi Ledford 25 September 2015 Justin Knight Photography Synthetic biologist Feng Zhang is
More informationPLNT2530 (2018) Unit 9. Genome Editing
PLNT2530 (2018) Unit 9 Genome Editing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 Genome Editing
More information2018 Protein Modeling Exam Key
2018 Protein Modeling Exam Key Multiple Choice: 1. Which of the following amino acids has a negative charge at ph 7? a. Gln b. Glu c. Ser d. Cys 2. Which of the following is an example of secondary structure?
More informationCRISPR-Cas immunity in prokaryotes
doi:10.1038/nature15386 CRISPR-Cas immunity in prokaryotes Luciano A. Marraffini 1 Prokaryotic organisms are threatened by a large array of viruses and have developed numerous defence strategies. Among
More informationMultiplex Genome Engineering Using CRISPR/Cas Systems
Multiplex Genome Engineering Using CRISPR/Cas Systems The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation As Published Publisher
More informationCRISPR as a strong gene editing tool
BMB Reports BMB Rep. 2017; 50(1): 20-24 www.bmbreports.org Contributed Mini Review CRISPR as a strong gene editing tool Shengfu Shen 1, Tiing Jen Loh 2, Hongling Shen 2, Xuexiu Zheng 2, * & Haihong Shen
More informationApplications of Cas9 nickases for genome engineering
application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,
More informationDeveloping the CRISPR Interference System to Understand Bacterial Gene Function
Developing the CRISPR Interference System to Understand Bacterial Gene Function Dept. of Veterinary Microbiology and Preventative Medicine Megan Weems, April Nelson, Victoria Thompson, Dr. Gregory Phillips
More informationCRISPR-based adaptive and heritable immunity in prokaryotes
Review CRISPR-based adaptive and heritable immunity in prokaryotes John van der Oost, Matthijs M. Jore, Edze R. Westra, Magnus Lundgren and Stan J.J. Brouns Laboratory of Microbiology, Wageningen University,
More informationA Guide to CRISPR/Cas9
Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse
More informationCPISPR-CAS: From a Prokaryotic Immune System to a Gene Editing Tool
Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2016 CPISPR-CAS: From a Prokaryotic Immune System to a Gene Editing Tool Wenyan Jiang Follow this and additional works at: http://digitalcommons.rockefeller.edu/
More informationGenome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
More informationNew Plant Breeding Technologies
New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations
More informationTesting Non-Transgenic CRISPR Technology for Wheat Improvement 13 TH IWGS - TULLN, AUSTRIA
Testing Non-Transgenic CRISPR Technology for Wheat Improvement KALI M BRANDT, HILARY L GUNN, BRETT L BUSCHKE, ADAM HEESACKER, NATHALIA MORET TI, ALEXANDER KARASEV, ROBERT S ZEMETRA 13 TH IWGS - TULLN,
More informationTechnology. offer: New. method
Technology offer: New method to detect spacer acquisition in CRISPR structures Technology offer: New method to detect spacer acquisition in CRISPR structures. SUMMARY CRISPR structures are a component
More informationUsing CRISPR for genetic alteration
Using CRISPR for genetic alteration Joffrey Mianné. j.mianne@har.mrc.ac.uk Mary Lyon Centre, MRC Harwell. CRISPR/Cas origins Origin of the CRISPR/Cas system: Clustered-Regularly Interspaced Short Palindromic
More informationMECHANISM OF FOREIGN DNA RECOGNITION AND DEGRADATION BY THE TYPE I CRISPR SYSTEM IN ESCHERICHIA COLI. by Sabin Mulepati
MECHANISM OF FOREIGN DNA RECOGNITION AND DEGRADATION BY THE TYPE I CRISPR SYSTEM IN ESCHERICHIA COLI by Sabin Mulepati A dissertation submitted to Johns Hopkins University in conformity with the requirements
More informationTALENs (Transcription Activator-Like Effector Nucleases)
TALENs (Transcription Activator-Like Effector Nucleases) The fundamental rationale between TALENs and ZFNs is similar, namely, combine a sequencespecific DNA-binding peptide domain with a nuclease domain
More informationCRISPR Systems: RNA-Guided Defence Mechanisms in Bacteria and Archaea
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 4 Number 6 (2015) pp. 187-200 http://www.ijcmas.com Review Article CRISPR Systems: RNA-Guided Defence Mechanisms
More informationApplications Of Genome Editing Tools In Drug Discovery And Basic Research
Applications Of Genome Editing Tools In Drug Discovery And Basic Research Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen
More informationTECHNOLOGIES. 3/19/18 Kayla Nygaard. https://i.ytimg.com/vi/pxw5yya-kh0/maxresdefault.jpg
TECHNOLOGIES 3/19/18 Kayla Nygaard https://i.ytimg.com/vi/pxw5yya-kh0/maxresdefault.jpg CRISPR IN THE NEWS CRISPR in 2018: Coming to a Human Near You Sickle-cell treatment clinical trials CRISPR Therapeutics
More informationContents. 1 History. 1.1 Repeated sequences. 1.2 CRISPR-associated systems. 1.3 Cas Cpf Predecessors 2 Locus structure
CRISPR From Wikipedia, the free encyclopedia Clustered regularly interspaced short palindromic repeats (CRISPR, pronounced crisper [2] ) are segments of prokaryotic DNA containing short, repetitive base
More informationCRISPR Technology- The Discovery,TheTechnology and its Implications SUMAN UPADHYAY MSC STUDENT IN BIOLOGY
CRISPR Technology- The Discovery,TheTechnology and its Implications SUMAN UPADHYAY MSC STUDENT IN BIOLOGY Introduction Clustered regularly-interspaced short palindromic repeats (abbreviated as CRISPR are
More informationCRISPR. CRISPR/Cas /15/17, 04?52 Page 1 of 316
CRISPR CRISPR/Cas9 Page 1 of 316 Diagram of the CRISPR prokaryotic antiviral defense mechanism. [1] CRISPR (/ˈkrɪspər/) is a family of DNA sequences in bacteria that contains snippets of DNA from viruses
More informationAdaptation in CRISPR-Cas Systems.
Adaptation in CRISPR-Cas Systems. Item type Authors Article Sternberg, Samuel H; Richter, Hagen; Charpentier, Emmanuelle; Qimron, Udi Citation Adaptation in CRISPR-Cas Systems. 2016, 61 (6):797-808 Mol.
More informationGiedrius Gasiūnas. Mechanism of DNA interference by Type II CRISPR/Cas systems
VILNIUS UNIVERSITY Giedrius Gasiūnas Mechanism of DNA interference by Type II CRISPR/Cas systems Doctoral dissertation Physical science, biochemistry (04 P) Vilnius, 2012 The work presented in this doctoral
More informationCRISPR/Cas9 and Targeted Genome Editing: A New Era in Molecular Biology. Tips for Planning Your CRISPR/Cas9 Experiments
CRISPR/Cas9 and Targeted Genome Editing: A New Era in Molecular Biology Tips for Planning Your CRISPR/Cas9 Experiments feature article CRISPR/Cas9 and Targeted Genome Editing: A New Era in Molecular Biology
More informationSupplementary Materials for
Originally published 3 January 2013; corrected 13 June 2014 www.sciencemag.org/cgi/content/full/science.1231143/dc1 Supplementary Materials for Multiplex Genome Engineering Using CRISPR/Cas Systems Le
More informationMethods for Reverse genetics References:
Methods for Reverse genetics References: 1. Alonso JM, Ecker JR. Moving forward in reverse: genetic technologies to enable genomewide phenomic screens in Arabidopsis. Nat Rev Genet. 2006 Jul;7(7):524-36.
More informationIntroducing Your Students To Gene Editing With CRISPR
Introducing Your Students To Gene Editing With CRISPR Brian Ell, Ph.D. Edvotek www.edvotek.com Follow @Edvotek EDVOTEK Biotech The Biotechnology Education Company Celebrating 30 years of science education!
More informationThis is the published version of a paper published in FEMS Microbiology Reviews. Citation for the original published paper (version of record):
http://www.diva-portal.org This is the published version of a paper published in FEMS Microbiology Reviews. Citation for the original published paper (version of record): Plagens, A., Richter, H., Charpentier,
More informationLaboratory Exercise Discovery of Escherichia coli CRISPR Sequences in an Undergraduate Laboratory
Laboratory Exercise Discovery of Escherichia coli CRISPR Sequences in an Undergraduate Laboratory Kevin T. Militello* Justine C. Lazatin From the Biology Department, State University of New York at Geneseo,
More informationPurification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost
Purification and Sequencing of DNA Guides from Prokaryotic Argonaute Daan C. Swarts *, Edze R. Westra, Stan J. J. Brouns and John van der Oost Department of Agrotechnology and Food Sciences, Wageningen
More informationBiotechnology. Review labs 1-5! Ch 17: Genomes. Ch 18: Recombinant DNA and Biotechnology. DNA technology and its applications
Biotechnology DNA technology and its applications Biotechnology and Molecular Biology Concepts: Polymerase chain reaction (PCR) Plasmids and restriction digests Recombinant protein production UV spectrophotometry
More informationGene Editing EDITION. An Introduction To Gene Editing
Gene Editing 101 2017 EDITION An Introduction To Gene Editing PRODUCED BY: IN PARTNERSHIP WITH: WELCOME ince the 1970 s, the idea of inserting new DNA into an organism s genome has been the focus of many
More informationEric Paul Bennett, MSc, Dr.med. Cellular Indel Profiles and Dynamics CRISPR/Cas9 delivery formats: Applying in vitro methodologies ex vivo
Copenhagen Center for Glycomics/Department of Odontology Eric Paul Bennett, MSc, Dr.med. Cellular Indel Profiles and Dynamics CRISPR/Cas9 delivery formats: Applying in vitro methodologies ex vivo Eric
More informationComparative Genomics: Background and Strategy
Comparative Genomics: Background and Strategy Parimala Devi Lori Gladley Emily Norris Dhruvi Patel Jennifer Pentz Ying Sha Yuehui Zhao Meningococcal meningitis Disease caused by the bacterium Neisseria
More informationGenome Editing with Programmable Nucleases. Jin-Soo Kim Department of Chemistry Seoul National University
Genome Editing with Programmable Nucleases Jin-Soo Kim Department of Chemistry Seoul National University 1 Method of the Year 2011: Engineered Nucleases RNA-guided Cas9 Endonuclease 3 FokI and the First
More informationBi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , ,
Bi 8 Lecture 18 Other RNAs as regulators and RNAs as enzymes Ellen Rothenberg 3 March 2016 Read: Alberts et al.: Chapter 6, pp. 317-324, 346-347, 362-366 RNA is more than a protein coding molecule RNA
More informationLentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors
Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Cat# Product Name Amount Application grna-h1-gb grna-h1-gp grna-h1-rb grna-h1-rp grna-h1-puro grna-h1-bsd grna-u6-gb
More informationCRISPR transcript processing: a mechanism for generating a large number of small interfering RNAs
Djordjevic et al. Biology Direct 2012, 7:24 RESEARCH Open Access CRISPR transcript processing: a mechanism for generating a large number of small interfering RNAs Marko Djordjevic 1*, Magdalena Djordjevic
More informationGENETIC TRANSFER AND RECOMBINATION
GENETIC TRANSFER AND RECOMBINATION Genetic recombination! Genetic recombination is the rearrangement of genes to form new combinations. If two chromosomes break and are rejoined in such a way that some
More informationCpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System
Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation As
More informationCpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System
Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation As
More informationTHE CRISPR-CAS9 DISPUTE
WHO OWNS THE INTELLECTUAL PROPERTY? THE CRISPR-CAS9 DISPUTE UTRF Tech Talks Dr. Lakita Cavin February 23, 2017 WHAT IS CRISPR-Cas9 Clustered Regularly-Interspaced Short Palindromic Repeats/CRISPR associated
More informationMutations in Cas9 Enhance the Rate of Acquisition of Viral Spacer Sequences during the CRISPR-Cas Immune Response
Short Article Mutations in Cas9 Enhance the Rate of Acquisition of Viral Spacer Sequences during the CRISPR-Cas Immune Response Graphical Abstract Authors Robert Heler, Addison V. Wright, Marija Vucelja,
More informationOptimizing CRISPR ribonucleoprotein components for precision genome editing
Optimizing CRISPR ribonucleoprotein components for precision genome editing Justin Barr Sr. Product Manager, Integrated DNA Technologies VIB CRISPR User Meeting 18 September 2018 1 Agenda Overview of CRISPR-Cas9
More informationRequirements for the targeting of foreign
Requirements for the targeting of foreign DNA by the Escherichia coli CRISPR/Cas system Mirthe Hoekzema Degree project in applied biotechnology, Master of Science (2 years), 2011 Examensarbete i tillämpad
More informationOptimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing
Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Mark Behlke MD, PhD Chief Scientific Officer February 24, 2016 1 Implementing CRISPR/Cas9 gene editing 2 To focus on RNA
More informationBacterial defense mechanisms against bacteriophages. B.G.E.T Jayashantha B.Sc (ug) Microbiology (Special), University of Kelaniya, Sri Lanka
Bacterial defense mechanisms against bacteriophages B.G.E.T Jayashantha B.Sc (ug) Microbiology (Special), University of Kelaniya, Sri Lanka Objective To study the defense mechanisms associated with bacteria
More informationA bacteriophage encodes its own CRISPR/Cas adaptive response to evade host innate immunity
A bacteriophage encodes its own CRISPR/Cas adaptive response to evade host innate immunity The Harvard community has made this article openly available. Please share how this access benefits you. Your
More informationSNITTS conference, Innovation by Collaboration September 22 nd, 2017, Stockholm Theme: Innovative processes for knowledge utilization
SNITTS conference, Innovation by Collaboration September 22 nd, 2017, Stockholm Theme: Innovative processes for knowledge utilization Knut J. Egelie, PhD candidate CIP NTNU Head of IPR Management, NTNU
More informationCRISPR-Cas9 Mediated Capsule Gene Silencing in Escherichia coli
Novelty in Biomedicine Original Article CRISPR-Cas9 Mediated Capsule Gene Silencing in Escherichia coli Mojgan Bandehpour 1,2,3*, Tina Nafarieh 2, Fatemeh Zahedipour 2, Afsaneh Tavasoli 2, Bahram Kazemi
More informationCRISPR: A Simple Tool for Answering Complex Questions
CRISPR: A Simple Tool for Answering Complex Questions www.bcm.edu/cbass c_bass@bcm.edu 713-798-8987 CRISPR-Cas systems CRISPRs: Clustered Regularly Interspaced Short Palindromic Repeats Cas: The accompanying
More informationviruses ISSN
Viruses 2012, 4, 2291-2311; doi:10.3390/v4102291 Review OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Function and Regulation of Clustered Regularly Interspaced Short Palindromic Repeats
More informationHow the other half lives: CRISPR-Cas s influence on bacteriophages
How the other half lives: CRISPR-Cas s influence on bacteriophages Melia E. Bonomo 1,3 and Michael W. Deem 1,2,3 arxiv:1711.09113v1 [q-bio.pe] 24 Nov 2017 1 Department of Physics and Astronomy, Rice University,
More informationGuide RNA Functional Modules Direct Cas9 Activity and Orthogonality
Short Article Guide RNA Functional Modules Direct Cas9 Activity and Orthogonality Alexandra E. Briner, 1,5 Paul D. Donohoue, 2,5 Ahmed A. Gomaa, 3,4,5 Kurt Selle, 1 Euan M. Slorach, 2 Christopher H. Nye,
More informationGenome Engineering with ZFNs, TALENs and CRISPR/Cas9
Genome Engineering with ZFNs, TALENs and CRISPR/Cas9 Designer Endonucleases ZFNs (zinc finger nucleases), TALENs (transcription activator-like effector nucleases) and CRISPR/Cas9 (clustered regularly interspaced
More informationIMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS
IMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS YONGLUN LUO (ALUN) ALUN@BIOMED.AU.DK VIB, NOV. 21. 2017 Associate Professor, Department of Biomedicine, Aarhus University, Denmark Executive Director,
More informationTALENs and CRISPR/Cas9 for Rice-Genome Editing
TALENs and CRISPR/Cas9 for Rice-Genome Editing Bing Yang Iowa State University Ames, Iowa byang@iastate.edu Rice, Oryza sativa L., is an important staple crop that feeds more than half of the world s population.
More informationGenome edi3ng with the CRISPR-Cas9 system
CRISPR-Cas9 Genome Edi3ng Bootcamp AHA Council on Func3onal Genomics and Transla3onal Biology Narrated video link: hfps://youtu.be/h18hmftybnq Genome edi3ng with the CRISPR-Cas9 system Kiran Musunuru,
More informationCRISPR 101: Optimizing Your Gene Editing Experiments
CRISPR 101: Optimizing Your Gene Editing Experiments PRESENTER Michele Auldridge, Ph.D. Senior Scientist, R&D MODERATOR Beth Frey Product Manager Agenda 1 Technology Overview 2 Experimental Decisions 3
More informationTALEN and CRISPR/Cas Genome Editing Systems: Tools of Discovery
TALEN and CRISPR/Cas Genome Editing Systems: Tools of Discovery A. A. Nemudryi 1,2,3,, K. R. Valetdinova 1,2,3,4,, S. P. Medvedev 1,2,3,4, S. M. Zakian 1,2,3,4* 1 Institute of Cytology and Genetics, Siberian
More informationClustered regularly interspaced short palindromic repeat
Highly efficient primed spacer acquisition from targets destroyed by the Escherichia coli type I-E CRISPR-Cas interfering complex Ekaterina Semenova a, Ekaterina Savitskaya b,c, Olga Musharova b,d,e, Alexandra
More informationStructural insights into the inactivation of CRISPR-Cas systems by diverse anti-crispr proteins
Zhu et al. BMC Biology (2018) 16:32 https://doi.org/10.1186/s12915-018-0504-9 REVIEW Structural insights into the inactivation of CRISPR-Cas systems by diverse anti-crispr proteins Yuwei Zhu *, Fan Zhang
More informationA versatile framework for microbial engineering using synthetic noncoding
FOCUS ON synthetic biology REVIEWS A versatile framework for microbial engineering using synthetic noncoding RNAs Lei S. Qi 1 3 and Adam P. Arkin 3 5 Abstract Synthetic non-coding RNAs have emerged as
More informationABSTRACT. LEENAY, RYAN THOMAS. Discovering, Characterizing, and Applying CRISPR-Cas Systems in Bacteria. (Under the direction of Dr. Chase Beisel.
ABSTRACT LEENAY, RYAN THOMAS. Discovering, Characterizing, and Applying CRISPR-Cas Systems in Bacteria. (Under the direction of Dr. Chase Beisel.) CRISPR-Cas (clustered regularly interspaced short palindromic
More informationBiotechnology. Cloning. Transformation 2/4/ glue DNA
Biotechnology Cloning The production of multiple copies of a single gene (gene cloning) For basic research on genes and their protein products To make a protein product (insulin, human growth hormone)
More informationEfficient Transcriptional Gene Repression by Type V-A CRISPR-Cpf1
Supporting Information Efficient Transcriptional Gene Repression by Type V-A CRISPR-Cpf1 from Eubacterium eligens Seong Keun Kim,,,# Haseong Kim,,,# Woo-Chan Ahn, Kwang-Hyun Park, Eui-Jeon Woo,, Dae-Hee
More informationAmplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events
Amplicons, Heteroduplexes and Enzymes - Proper Processing Elevates Detection of CRISPR Gene Editing Events Steve Siembieda, MS MBA VP Commercialization ABRF Conference February 2015 What Is CRISPR? Clustered
More informationSequence Analysis Lab Protocol
Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136
More informationTitle (15 words max): CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER), a novel method for selective transformation
Title (15 words max): CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER), a novel method for selective transformation Authors: Rothschild, L. J., Greenberg, D. T.*, Takahashi, J. T.*, Thompson,
More informationControl of Metabolic Processes
Control of Metabolic Processes Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College As described earlier, the metabolic processes occurring within living organisms (glycolysis, respiration,
More informationThe CRISPR System: Small RNA-Guided Defense in Bacteria and Archaea
The CRISPR System: Small RNA-Guided Defense in Bacteria and Archaea Fedor V. Karginov 1,2, * and Gregory J. Hannon 1,2, * 1 Watson School of Biological Sciences 2 Howard Hughes Medical Institute Cold Spring
More informationChapter 18. Viral Genetics. AP Biology
Chapter 18. Viral Genetics AP Biology What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron microscope size smaller than ribosomes ~20 50 nm
More informationViral Genomes. Genomes may consist of: 1. Double Stranded DNA 2. Double Stranded RNA 3. Single-stranded RNA 4. Single-stranded DNA
Chapter 19 Viral Genomes Genomes may consist of: 1. Double Stranded DNA 2. Double Stranded RNA 3. Single-stranded RNA 4. Single-stranded DNA Genome is usually organized as a single linear or circular molecule
More informationConformational Control of Cascade Interference and Priming Activities in CRISPR Immunity
Short Article Conformational Control of Cascade Interference and Priming Activities in CRISPR Immunity Graphical Abstract Authors Chaoyou Xue, Natalie R. Whitis, Dipali G. Sashital Correspondence sashital@iastate.edu
More informationIndicate which three questions you would like to be graded.
MCB 110 Spring 2017 Exam 1I KEY FIVE PAGES NAME: SID Number: Question Maximum Points Your Points I 50 II 50 III 50 IV 50 150 Indicate which three questions you would like to be graded. PLEASE WRITE your
More informationPooled CRISPR guide RNA libraries for functional genomics screening: Do you know what s in your library?
Pooled CRISPR guide RNA libraries for functional genomics screening: Do you know what s in your library? Peter Sheffield R&D Scientific Program Director Agilent Technologies INTRODUCTION CRISPR: A Programmable
More informationRNA Targeting by Functionally Orthogonal Type VI-A CRISPR-Cas Enzymes
Article RNA Targeting by Functionally Orthogonal Type VI-A CRISPR-Cas Enzymes Graphical Abstract Authors Alexandra East-Seletsky, Mitchell R. O Connell, David Burstein, Gavin J. Knott, Jennifer A. Doudna
More informationRNA Targeting by Functionally Orthogonal Type VI-A CRISPR-Cas Enzymes
Article RNA Targeting by Functionally Orthogonal Type VI-A CRISPR-Cas Enzymes Graphical Abstract Authors Alexandra East-Seletsky, Mitchell R. O Connell, David Burstein, Gavin J. Knott, Jennifer A. Doudna
More information