Supporting Information. Mass Spectrometry Based Ultrasensitive DNA Methylation. Profiling Using Target Fragmentation Assay

Size: px
Start display at page:

Download "Supporting Information. Mass Spectrometry Based Ultrasensitive DNA Methylation. Profiling Using Target Fragmentation Assay"

Transcription

1 Supporting Information Mass Spectrometry Based Ultrasensitive DNA Methylation Profiling Using Target Fragmentation Assay Xiang-Cheng Lin, Ting Zhang, Lan Liu, Hao Tang*, Ru-Qin Yu, Jian-Hui Jiang* State Key Laboratory for Chemo/biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha, , P. R. China * Corresponding author. Tel.: ; Fax: address: haotang@hnu.edu.cn, jianhuijiang@hnu.edu.cn S-1

2 EXPERIMENTAL SECTION Materials. Streptavidin-modified beads (1 µm, 10 mg/ml) were obtained Thermo Fisher Scientific Inc.. Restriction endonuclease BbvI (recognition site GCAGC) and Dam MTase (Dnmt1) were purchased from New England Biolabs (NEB). All the oligonucleotides were synthesized from Sangon Inc. (Shanghai, China). The sequences of synthetic oligonucleotides are listed in Table S1. All other chemicals were of analytical grade and obtained from Sinopharm Chemical Reagent Co. Ltd (Shanghai, China). The solutions used in all experiments were prepared using ultrapure water which was obtained through a Millipore Milli-Q water purification system (Billerica, MA) and had an electric resistance >18.2 MΩ. Magnetic beads immobilized with the capture probes were prepared by incubating the biotinylated probes (5 µl, 1 µm) with the magnetic beads (20 µl) in a Bind and Wash (B&W) buffer (10 mm Tris-HCl, 1 mm EDTA, 2M NaCl, ph 7.5) for 15 min. After the supernatant discarded, the capture magnetic beads were obtained and stored in 4 o C for futher use. Prostate tissue samples were friendly provided by the Third XiangYa Hospital (Changsha, China), which was approved by the local institutional review board. All samples are biopsies from 20 patients, one diagnosed to be normal, three were diagnosed with benign hyperplasia, and 16 were diagnosed with prostate cancer. Genomic DNA from formalin-fixed and paraffin-embedded tissue sections were isolated and extracted using QIAamp DNA mini kit (QIAGEN) according to the manufacturer s instructions. Briefly, the tissue samples were lysed thoroughly with lysis buffer containing proteinase K, followed by incubating at 56 o C for 3 h. In order to avoid RNA interference, RNase A was added to the tissue lysate. The lysate was then passed through the QIAamp spin mini column to allow the genomic DNA to be adsorbed in the column. The genomic DNA was purified by washing with water twice and collecting the elution products. DNA concentration and quality were evaluated by absorbance at 260 and 280 nm, respectively, S-2

3 using a Lambda 850 UV-vis spectrophotometer (PerkinElmer). The concentration of genomic DNA was estimated to be ~25 µg/ml. Target capture and fragmentation. Genomic DNA of 100 µl was digested with restriction endonuclease BbvI (10 µl, 2000 U/mL, 37 o C) in NEB CutSmart buffer (50 mm KAc, 20 mm Tris-Ac, 10 mm MgAc 2, 100 µg/ml BSA, ph 7.9) for 1 h. After denatured at 95 o C for 5 min and quickly cooled in ice water for 5 min, the capture magnetic beads (20 µl) was added and incubated with the digested DNA in phosphate buffered saline (PBS, 10 mm Na 2 HPO 4, mm NaCl, 2.7 mm KCl, ph 7.4) containing 0.5 M NaCl for 1 h. After magnetic separation, the collected beads were mixed with 0.2 ml of aqueous formic acid (88% w/w) and hydrolyzed at 160 o C for 30 min. The hydrolysates was evaporated under nitrogen and then dissolved in 10 µl methanol-water (1:1) followed by MS analysis. DNA methylation using Dnmt1 and study of its inhibitor. A DNA hairpin probe with one 5mC (Table S1) was designed as substrate for Dnmt1 to study DNA methylation and screening of Dnmt1 inhibitor. In the presence of Dnmt1, methylation occurred at another C of the CpG site in the hairpin probe. The methylation experiment was performed in 50 µl of methylase buffer (50 mm of Tris-HCl, 1 mm EDTA, 1 mm DTT,5% glycerol) containing 0.1µM DNA hairpin probe,100 µg/ml BSA, 100 µm S-adenosylmethionine, with different amounts of Dnmt1 and inhibitor(5-azacytidine). The reaction mixture was incubated at 37 C for 4 h. DNA hydrolytes were obtained using the same procedure and subjected for MS measurement. To investigate the effect of inhibitor on DNA methylation, a group of different concentrations of inhibitors and the fixed concentration of Dnmt1 (40 U/mL) were used. Mass spectrometry analysis. MS analysis was performed using an LCQ Orbitrap Velos Pro mass spectrometer (Thermo Fisher Scientific). The sample was directly delivered using a syringe pump at flow rate of 500 nl/min into the mass spectrometer furnished with a nano electrospray ionization (nano-esi) source under the positive-ion S-3

4 mode. The spray voltage was 2.0 kv, and the source temperature was at 270 o C. For primary mass spectrometry, data was acquired in full scan mode. MS/MS mode was employed for measurement and higher energy collisionally activated dissociation (HCD) was chosen for post-source fragmentation with 90 ev collision energy. Mass spectrometry was operated in selective ion scan mode for MS/MS by monitoring a transition pair of m/z (molecular ion)/ (fragment ion) for 5-methylcytosine and m/z / for adenine, with a scan time of 50 ms for each pair. Quantification was accomplished by averaging response signals within 1 min. Methylation-specific PCR for tissue samples. Methylation-specific PCR of genomic DNA was used for qualitative analysis of DNA methylation according to a procedure described previously. 1 Briefly, target DNA that was captured using magnetic beads from 1 µg genomic DNA was treated using the EpiTect Bisulfite Kit (QIAGEN) according to the manufacturer s instructions. PCR amplification of the bisulfite-treated DNA was performed in two separate reactions with primer pairs specific for the non-methylated (U) or the methylated (M) sequences. The sequences for methylation-specific PCR primers are given in Table S3. PCR reaction mixture (25 µl) contained 0.3 µm primers, 100 µm dntps, 2.0 U JumpStart Taq polymerase (Sigma) and 1 µl of bisulfite treated DNA. The PCR conditions were as follows: 94 o C for 1 min, 35 cycles of (94 o C for 30 s, 65 o C for 25 s and 72 o C for 30 s), and 72 C for 5 min. The PCR products were separated on 2.5% agarose gels and visualized by ethidium bromide staining. REFERENCES (1) Claus, R.; Wilop, S.; Hielscher, T.; Sonnet, M.; Dahl, E.; Galm, O.; Jost, E.; Plass, C. Epigenetics 2012, 7, S-4

5 Table S1. Sequences of the synthesized oligonucleotides Probes Sequence (5 to 3 ) DNA Target 1 GGG GCG GAG CGG GGC GGG ACC ACC C DNA Target 2 GGG G(5mC)G GAG (5mC)GG GG(5mC) GGG ACC ACC C DNA Target 3 GCG G(5mC)C CAG (5mC)GC CG(5mC) GCG ACC ACC C DNA Target 4 GGG G(5mC)G GAG CGG GGC GGG ACC ACC C DNA Target 5 GGG G(5mC)G GAG (5mC)GG GGC GGG ACC ACC C Capture Probe 1 (GSTP 1) Capture Probe 2 (BCL 2) Biotin-TTTTTTTTTTGGGTGGTCCCGCCCCGCTCCGCCCC Biotin-TTTTTTTTTTCTCCGCCCCGCTCCCTGGCCCGGGT Capture Probe 3 (ESR 1) Capture Probe 4 (HIC 1) Biotin-TTTTTTTTTTGCTCTGGCCCCGGCCCTGCCCCGGG Biotin-TTTTTTTTTTCCCGTCCCTCCCGGTCCCCGGCTCG DNA hairpin probe ATGTCGGCG (5mC)ATCAGTTTTCTGATGCGCCGACAT S-5

6 Table S2. Sequences of promoters for select genes a GSTP1 gtgcagcggccgccg//gggctggggccggcgggagtccgcgggaccctccagaagagcggc CGGCGCCGTGACTCAGCACTGGGGCGGAGCGGGGCGGGACCACCCTTATAAGGCTCG GAGGCCGCGAGGCCTTCGCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCAGTGAGTAC GCGCGGCCCGCGTCCCCGGGGATGGGGCTCAGAGCTCCCAGCATGGGGCCAACCCGC AGCATCAGGCC//cgggctccc BCL2 gcgcagcggagcggg//cgggtggccggcccggacgcgccctccccggccgcggccccgcgcg CCATGTGCCCCCGGCGGGACGCGCCACTCCCGGGCCTGCCGCGGCGCCTTTAACCCGG GCCAGGGAGCGGGGCGGAGGGGGCGGTCGGGTGGCTCAGAGGAGGGCTCTTTCTTTC TTCTTTTTTTGAATGAACCGTGTGACGTTACGCACAGGAAACCGGTCGGGCTGTGCAG AGAATGAAGTAAGAGGACAGGCACCACAGCCCCGCTCCCGCCCCCTTCCTCCCGCGC CCGCCCCTCCGCGCCGCCTGCCCGCCCGCCCGCCGCGCTCCCGCCCGCCGCTCTCCGT GGCCCCGCCGCGCTGCCGCCGCCGCCGCTGCCAGCGAAGGTGCCGGGGCTCCGGGCC CTCCCTGCCGGCGGCCGTCAGCGCTCGGAGCGGGCTGCGCGGCGGGAGCTCCGGGAG GCGGCCGTAGCCAGCGCCGCCGCGCAGGACCAGGAGGAGGAGAAAGGGTGCGCAGC CCGGAGGC//ggggtgcgcc ESR1 cagcagcgacgacaa//gtaaagtaaagttcagggaagctgctctttgggatcgctccaaatcg AGTTGTGCCTGGAGTGATGTTTAAGCCAATGTCAGGGCAAGGCAACAGTCCCTGGCCG TCCTCCAGCACCTTTGTAATGCATATGAGCTCGGGAGACCAGTACTTAAAGTTGGAGGC CCGGGAGCCCAGGAGCTGGCGGAGGGCGTTCGTCCTGGGACTGCACTTGCTCCCGTC GGGTCGCCCGGCTTCACCGGACCCGCAGGCTCCCGGGGCAGGGCCGGGGCCAGAGCT CGCGTGTCGGCGGGACATGCGCTGCGTCGCCTCTAACCTCGGGCTGTGCTCTTTTTCCA S-6

7 GGTGGCCCGCCGGTTTCTGAGCCTTCTGCCCTGCGGGGACACGGTCTGCACCCTGCCC GCGGCCACGGACCATGACCATGACCCTCCACACCAAAGCATCTGGGATGGCCCTACTG CATCAGATCCAAGGGAACGAGCTGGAGCCCCTGAACCGTCCGCAGCTCAAGATC//cccct ggagc HIC1 gcgcagccacgtccc//ccctggatccgccgtcagccgggcccggggctttcgacatgcccccc AGGTGGGTCCTCGAGCCGGGGACCGGGAGGGACGGGGGACCCGGGACAGCCCGGTC CTCGTGCGTCGGCCGCCTCGGGTGCATCTTCTGGCGCGGGTGCCCCATCGCGGCTGGC GGCTGGCGTTCAGGGCTCCGGGTGTCGTCCCTTTCGGACTCAGGACCACCGGGCCGC GGCTCCGCGCCGGGTTCACGGCGGGGTCAGCGGCCCGGGGCCGGCTCTGCCCGCACA TGGGCTGGAGAGGCGAGGGGAAGGGAAGGGAAGGGGAGCTGGCGGGCGGGGCTGG CAGGGGCGCTGCCCTGGCACAGCTCGGGGCCTGGCAGCGGCGGGTG//gggcatcg a // denotes the cleavage site of restriction endonuclease BbvI, and the sequences to be captured by magnetic separation were denoted by capital letters. S-7

8 Table S3. Primers for selected sequences using in Methylation-specific PCR a GSTP1 MF TTT TAG AAGA GC GGT CG GC GTC MR UF UR TCC GCG CGTACTCACTAATAACG TTT TAG AAGA GT GGT TG GT GTTG CAAACCACACATACTCACTAATAACA BCL2 MF GTGTGACGTTACGTATAGGAAATC MR UF UR GACGACGCTAACTACGACCG GTGTGATGTTATGTATAGGAAATT ACACAACAACACTAACTACAACCA ESR1 MF ATTTGTTTTCGTCGGGTC MR UF UR TCATAATCCGTAACCGCG TGTATTTGTTTTTGTTGGGTT ATAATCCATAACCACAAACAA HIC1 MF GATAGTTCGGTTTTCGTGCGTC MR UF UR GACCCGATAATCCTAAATCCG GGATAGTTTGGTTTTTGTGTGTT ACAACCCAATAATCCTAAATCCA a MF denotes the forward primers for PCR amplification of methylated target sequences, MR is the reverse primers for PCR amplification of methylated target sequences, UF denotes the forward primers for PCR amplification of non-methylated target sequences, and UR is the reverse primers for PCR amplification of non-methylated target sequences. S-8

9 Figure S1. The full scan mass spectrum of DNA target 2 without preliminary acidic degradation. Sample was dissolved in 10 nm ammonium acetate buffer, detected in negative ion mode. S-9

10 Figure S2.. The full scan mass spectrum of standard 5mC (30 nm). S-10

11 Figure S3. (A) The full scan mass spectrum for 5-methylcytosine, (B) the product ion scan spectrum obtained using the protonated molecular ion of 5-methylcytosine as the parent ion. S-11

12 Intensity of MS/MS Y=216.45X R 2 = mc (pm) Figure S4. Plot of MS/MS intensities versus concentrations of DNA target 2 (expressed in 5mC concentration). S-12

13 Figure S5. (A) The full scan mass spectrum for adenine, (B) the product ion scan spectrum obtained using the protonated molecular ion of adenine as the parent ion. S-13

14 4 Ratio of signal intensity (5m C/A) Y=1.7142X R 2 = Ratio of Concentrations (5mC/A) Figure S6. Calibration curve for ratios of MS/MS intensities for 5mC and A versus concentration ratios [5mC]/[A]. S-14

15 Figure S7. The MS/MS spectra of five targets obtained by monitoring 5-methylcytosine (A) and adenine (B). The targets were captured and acidic hydrolyzed. S-15

16 Figure S8. Methylation analysis for samples of mixtures of methylated and non-methylated DNA with different levels of [5mC]/([5mC] + [C]). S-16

17 Figure S9. Methylation-specific PCR of promoter sequences in GSTP1 (A), BCL2 (B), ESR1 (C), and HIC1 (D) genes. M denotes the bands obtained with methylation-specific primers, U denotes the bands obtained with non-methylation specific primers, and positive denotes the bands from a positive methylated target. Sample 1 was from normal person, sample 8-10 were from persons with benign hyperplasia, and the other 16 samples were from persons diagnosed with prostate cancer. (to be continued) S-17

18 Figure S9. (continued) The DNA methylation could be inferred from the presence of bands under M. Methylation in promoter sequences for GSTP1 gene was identified for samples 2-7 and 11-20, low methylation occurred from genomic DNA in sample 9, and only genomic DNA in samples of 1, 8 and 10 were non-methylated. Methylation in promoter sequences for BCL2 gene was found to occur for samples 2-7, and 20, and only genomic DNA in samples of 1, 8-10 and 19 were non-methylated. Methylation in promoter sequences for ESR1 gene was found for samples 3-5, 7, 12-20, and only genomic DNA in samples of 1, 2, 6, and 8-11 were non-methylated. Methylation in promoter sequences for HIC1 gene was found for samples 2-7, 12-20, low methylation occurred from genomic DNA in sample 10, and only genomic DNA in samples of 1, 8, and 9 were non-methylated. S-18

19 Figure S10. The MS/MS spectra of DNA hydrolysates from Dnmt1 and its inhibitor (5-azacytidine) treated DNA hairpin probe. (A) 5-methylcytosine; (B) adenine. Concentrations of Dnmt1 (plot 1: 0 U/mL; plot 2: 20 U/mL; plot 3-5: 40 U/mL). Concentration of 5-azacytidine (plot 1-3: 0 µm; plot 4: 5 µm; plot 5: 40 µm). Adensine was used as internal standard; hence the intensities of all samples were similar. The intensity of 5-methylcytosine increases (plot 1 to plot 3) along with the increase of Dnmt1 concentration (0, 20 U/mL and 40 U/mL ). Under the same concentration of Dnmt1 (40 U/mL ), the MS intensity of 5-methylcytosine decreases (plot 3 to plot 5) along with the increases of Dnmt 1 inhibitor concentration (0, 5, and 40 µm). Hence, Dnmt1 activity assay and screening of its inhibitor could be achieved by measuring MS intensity ratio of 5mC and A. S-19

Electronic Supplementary Information (ESI)

Electronic Supplementary Information (ESI) Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) A label free fluorescent assay for uracil-dna glycosylase

More information

Randomly arrayed G-rich DNA sequence for label-free and realtime. assay of enzyme activity

Randomly arrayed G-rich DNA sequence for label-free and realtime. assay of enzyme activity Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Randomly arrayed G-rich DNA sequence for label-free and realtime assay of enzyme activity Zhuoliang

More information

Supplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient

Supplementary information for. An Ultrasensitive Biosensor for DNA Detection Based on. Hybridization Chain Reaction Coupled with the Efficient Supplementary information for An Ultrasensitive Biosensor for DNA Detection Based on Hybridization Chain Reaction Coupled with the Efficient Quenching of Ruthenium Complex to CdTe Quantum Dot Yufei Liu,

More information

Supplementary Information. Binding-responsive catalysis of Taq DNA polymerase for sensitive. and selective detection of cell-surface proteins

Supplementary Information. Binding-responsive catalysis of Taq DNA polymerase for sensitive. and selective detection of cell-surface proteins Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2016 Supplementary Information Binding-responsive catalysis of Taq DNA polymerase for sensitive and

More information

Ren Lab ENCODE in situ HiC Protocol for Tissue

Ren Lab ENCODE in situ HiC Protocol for Tissue Ren Lab ENCODE in situ HiC Protocol for Tissue Pulverization, Crosslinking of Tissue Note: Ensure the samples are kept frozen on dry ice throughout pulverization. 1. Pour liquid nitrogen into a mortar

More information

A Cell-Surface-Anchored Ratiometric I-Motif Sensor for. Extracellular ph Detection

A Cell-Surface-Anchored Ratiometric I-Motif Sensor for. Extracellular ph Detection Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 216 Electronic Supplementary Information (ESI) A Cell-Surface-Anchored Ratiometric I-Motif Sensor for

More information

Electronic Supporting information (ESI)

Electronic Supporting information (ESI) Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supporting information (ESI) Hairpin DNA Probes Based on Target-induced in situ Generation

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Direct Detection of Circulating MicroRNA in Cancer Patient

More information

Supporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection

Supporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection Supporting Information Innate Reverse Transcriptase Activity of DNA Polymerase for Isothermal RNA Direct Detection Chao Shi, Xiaotong Shen, Shuyan Niu and Cuiping Ma *, Key Laboratory of Sensor Analysis

More information

The Development of an Indirect Competitive. Immunomagnetic-Proximity Ligation Assay for Small-Molecule. Detection

The Development of an Indirect Competitive. Immunomagnetic-Proximity Ligation Assay for Small-Molecule. Detection The Development of an Indirect Competitive Immunomagnetic-Proximity Ligation Assay for Small-Molecule Detection Xuecheng Jiang, a Zhenhong Zhu, ab Zhihao Sun, a Luming Wang, a Lixiao Zhou, a Hanqiang Miao,

More information

E.Z.N.A. Tissue RNA Kit. R preps R preps

E.Z.N.A. Tissue RNA Kit. R preps R preps E.Z.N.A. Tissue RNA Kit R6688-00 5 preps R6688-01 50 preps May 2015 E.Z.N.A. Tissue RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Important Notes...4 Homogenization

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Amplified Binding-Induced Homogeneous Assay through Catalytic

More information

catalytic hairpin DNA assembly for dual-signal amplification toward homogenous analysis of protein and

catalytic hairpin DNA assembly for dual-signal amplification toward homogenous analysis of protein and Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Programmable Mg 2+ -dependent DNAzyme switch by the catalytic hairpin DNA

More information

GRS Genomic DNA Kit BroadRange - #GK

GRS Genomic DNA Kit BroadRange - #GK revised: 18 05 2012 printed: 21 05 2012 GRS Genomic DNA Kit BroadRange - #GK06.0100 (FOR RESEARCH ONLY) Sample : up to 200µl of whole blood (fresh or frozen), up to 25 mg of tissue, up to 25mg of paraffinembedded

More information

Supporting Information. A one-step sensitive dynamic light scattering method for. adenosine detection using split aptamer fragments

Supporting Information. A one-step sensitive dynamic light scattering method for. adenosine detection using split aptamer fragments Supplementary Material (ESI) for Analytical Methods This journal is (c) The Royal Society of Chemistry 2011 Supporting Information for A one-step sensitive dynamic light scattering method for adenosine

More information

Bacteria Genomic DNA Purification Kit

Bacteria Genomic DNA Purification Kit Bacteria Genomic DNA Purification Kit Cat #:DP025/ DP025-150 Size:50/150 reactions Store at RT For research use only 1 Description: The Bacteria Genomic DNA Purification Kit provides a rapid, simple, and

More information

NEBNext RNase III RNA Fragmentation Module

NEBNext RNase III RNA Fragmentation Module SAMPLE PREPARATION NEBNext RNase III RNA Fragmentation Module Instruction Manual NEB #E6146S 100 reactions NEBNext RNase III RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Information An Affinity Capture Involved Enzymatic Assay for Thrombin by Using Peptide Aptamer as Affinity Ligands on Magnetic Beads Qiang Zhao a* Jie Gao b Research Center for

More information

Pinpoint Slide DNA Isolation System Catalog No. D3001

Pinpoint Slide DNA Isolation System Catalog No. D3001 INSTRUCTIONS Pinpoint Slide DNA Isolation System Catalog No. D3001 Highlights Easily isolates genomic DNA in any targeted microscopic tissue area on a slide. The simple procedure combines Pinpoint tissue

More information

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70

TECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70 GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously

More information

AmpliScribe T7-Flash Biotin-RNA Transcription Kit

AmpliScribe T7-Flash Biotin-RNA Transcription Kit AmpliScribe T7-Flash Biotin-RNA Transcription Kit Cat. No. ASB71110 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA276E AmpliScribe T7-Flash Biotin-RNA Transcription Kit 12/2016

More information

Electronic Supporting Information

Electronic Supporting Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supporting Information Phosphorylation-Induced Hybridization Chain Reaction on Beads:

More information

Electronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence

Electronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the

More information

DNA isolation from tissue DNA isolation from eukaryotic cells (max. 5 x 106 cells) DNA isolation from paraffin embedded tissue

DNA isolation from tissue DNA isolation from eukaryotic cells (max. 5 x 106 cells) DNA isolation from paraffin embedded tissue INDEX KIT COMPONENTS 3 STORAGE AND STABILITY 3 BINDING CAPACITY 3 INTRODUCTION 3 IMPORTANT NOTES 4 EUROGOLD TISSUE DNA MINI KIT PROTOCOLS 5 A. DNA isolation from tissue 5 B. DNA isolation from eukaryotic

More information

GENERATION OF HIC LIBRARY

GENERATION OF HIC LIBRARY GENERATION OF HIC LIBRARY Gel checking points during one HiC experiment ------ % gel Step Checking list 1 0.8 After cells are lysed Pellet degradation check 2 0.8 After template generation 1 template quality

More information

Note: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology

Note: for laboratory research use only. RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Signalway Biotechnology Note: for laboratory research use only RNA High-purity Total RNA Rapid Extraction Kit (Spin-column) Cat. #: RP1202 (50preps) Signalway Biotechnology I. Kit Content, Storage Condition and Stability Content

More information

A novel label-free cascade amplification strategy based dumbbell. probe-mediated rolling circle amplification-responsive

A novel label-free cascade amplification strategy based dumbbell. probe-mediated rolling circle amplification-responsive A novel label-free cascade amplification strategy based dumbbell probe-mediated rolling circle amplification-responsive G-quadruplex formation for highly sensitive and selective detection of NAD + or ATP

More information

Mirror-image polymerase chain reaction

Mirror-image polymerase chain reaction Supplementary Information Mirror-image polymerase chain reaction Wenjun Jiang 1,4, Baochang Zhang 2,4, Chuyao Fan 1,4, Min Wang 1,4, Jiaxing Wang 2, Qiang Deng 1, Xianyu Liu 1, Ji Chen 1, Jishen Zheng

More information

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK

EZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications

More information

Disassembly of gold nanoparticle dimers for colorimetric

Disassembly of gold nanoparticle dimers for colorimetric Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2015 Disassembly of gold nanoparticle dimers for colorimetric determination of ochratoxin

More information

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit

MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis

More information

Presto Food DNA Extraction Kit

Presto Food DNA Extraction Kit Instruction Manual Ver. 06.28.17 For Research Use Only Presto Food DNA Extraction Kit Advantages FGD004 (4 Preparation Sample Kit) FGD100 (100 Preparation Kit) FGD300 (300 Preparation Kit) Sample: 200

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

RayBio Genomic DNA Magnetic Beads Kit

RayBio Genomic DNA Magnetic Beads Kit RayBio Genomic DNA Magnetic Beads Kit Catalog #: 801-112 User Manual Last revised January 4 th, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100

More information

ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067

ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 INSTRUCTION MANUAL ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 Highlights 96-well plate recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage,

More information

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl

More information

Taq + dntps #EZ U

Taq + dntps #EZ U #EZ1012 500U Taq + dntps Concentration: 5U/μl Contents: Hy-Taq DNA polymerase 100μl 10xPCR Buffer (Mg2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C Description Hy-Taq 500U +

More information

Tissue & Cell Genomic DNA Purification Kit. Cat. #:DP021/ DP Size:50/150 reactions Store at RT For research use only

Tissue & Cell Genomic DNA Purification Kit. Cat. #:DP021/ DP Size:50/150 reactions Store at RT For research use only Tissue & Cell Genomic DNA Purification Kit Cat. #:DP021/ DP021-150 Size:50/150 reactions Store at RT For research use only 1 Description: The Tissue & Cell Genomic DNA Purification Kit provides a rapid,

More information

Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3. Supplementary Figure S4

Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3. Supplementary Figure S4 Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S3 Supplementary Figure S4 Supplementary Figure S5 Supplementary Figure S6 Supplementary Figure S7 Supplementary Figure S8 Supplementary

More information

Solid Phase cdna Synthesis Kit

Solid Phase cdna Synthesis Kit #6123 v.02.09 Table of Contents I. Description... 2 II. Kit components... 2 III. Storage... 2 IV. Principle... 3 V. Protocol V-1. Preparation of immobilized mrna... 4 Protocol A: Starting from Tissue or

More information

E.Z.N.A. Blood DNA Midi Kit. D preps D preps

E.Z.N.A. Blood DNA Midi Kit. D preps D preps E.Z.N.A. Blood DNA Midi Kit D3494-00 2 preps D3494-04 100 preps August 2013 E.Z.N.A. Blood DNA Midi Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing

More information

Gene Expression Profiling Applicable for Cells Cultivated in Channel-Slides

Gene Expression Profiling Applicable for Cells Cultivated in Channel-Slides Gene Expression Profiling Applicable for Cells Cultivated in Channel-Slides Gene expression profiling provides information about the transcriptome of a living cell. The DNA is transcribed into mrna, when

More information

BioTeke Corporation. Endotoxin-free Plasmid DNA Mini-preparation Kit. (Spin-column) Note: for laboratory research use only.

BioTeke Corporation. Endotoxin-free Plasmid DNA Mini-preparation Kit. (Spin-column) Note: for laboratory research use only. Note: for laboratory research use only. Endotoxin-free Plasmid DNA Mini-preparation Kit (Spin-column) Cat. # DP2601 (20 preps) DP2602 (50 preps) BioTeke Corporation 1 I. Kit Content Storage and Stability

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-DNA FFPE Kit Catalog Nos. D3067 Highlights Streamlined purification of high-quality FFPE tissue DNA that is ideal for PCR, Next-Gen library prep, enzymatic manipulations, etc.

More information

MicroElute Total RNA Kit. R preps R preps R preps

MicroElute Total RNA Kit. R preps R preps R preps MicroElute Total RNA Kit R6831-00 5 preps R6831-01 50 preps R6831-02 200 preps February 2014 MicroElute Total RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Multiplexed Detection of Lung Cancer Cells at the Single-Molecule

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Information Ultrasensitive quantification of mature micrornas by real-time PCR based on ligation of ribonucleotide-modified DNA probe Jiangyan Zhang, Zhengping Li,* Hui Wang, Yucong

More information

Supplementary Material. Efficient and scalable serial extraction of DNA and RNA from biobanked tissue samples

Supplementary Material. Efficient and scalable serial extraction of DNA and RNA from biobanked tissue samples Supplementary Material Efficient and scalable serial extraction of DNA and RNA from biobanked tissue samples Lucy Mathot, Monica Lindman and Tobias Sjöblom Department of Genetics and Pathology, Rudbeck

More information

Labeling Protocol for mytags Immortal Libraries

Labeling Protocol for mytags Immortal Libraries 5840 Interface Drive, Suite 101 Ann Arbor MI 48103 1 (734) 998 0751 techsupport@arborbiosci.com Labeling Protocol for mytags Immortal Libraries March 2018 Version 1.5 Contents Reagents and Equipment...

More information

Streptavidin Particles Technical Information

Streptavidin Particles Technical Information Streptavidin Particles Technical Information Streptavidin Streptavidin is a protein (MW of approx. 66,000) made up of four identical subunits, each containing a high affinity binding site for biotin (KD

More information

GeneMATRIX Tissue DNA Purification Kit

GeneMATRIX Tissue DNA Purification Kit GeneMATRIX Tissue DNA Purification Kit Kit for isolation of total DNA from human and animal tissues Cat. no. E3550 Version 5.1 April, 2008 Distributor: Roboklon GmbH Robert-Rössle-Str.10 B55 13125 Berlin

More information

Methylamp Coupled DNA Isolation & Modification Kit

Methylamp Coupled DNA Isolation & Modification Kit Methylamp Coupled DNA Isolation & Modification Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The Methylamp Coupled DNA Isolation & Modification Kit is very suitable for methylation research

More information

Ligation Independent Cloning (LIC) Procedure

Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered

More information

MeDIP-seq library construction protocol v2 Costello Lab June Notes:

MeDIP-seq library construction protocol v2 Costello Lab June Notes: MeDIP-seq library construction protocol v2 Costello Lab June 2010 Notes: A. For all Qiagen gel extraction steps (Qiaquick and MinElute), melt gel slice at 37º C instead of 50º (see Quail et al 2008 Nature

More information

Sequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps

Sequencing of DNA lesions facilitated by site-specific excision via base. excision repair DNA glycosylases yielding ligatable gaps Supporting information Sequencing of DNA lesions facilitated by site-specific excision via base excision repair DNA glycosylases yielding ligatable gaps Jan Riedl, Aaron M. Fleming, and Cynthia J. Burrows*

More information

Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

NEBNext Magnesium RNA Fragmentation Module

NEBNext Magnesium RNA Fragmentation Module SAMPLE PREPARATION NEBNext Magnesium RNA Fragmentation Module Instruction Manual NEB #E6150S 200 reactions NEBNext Magnesium RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

500U. Unit Definition. Storage Buffer. 10X PCR Buffer with Mg 2+

500U. Unit Definition. Storage Buffer. 10X PCR Buffer with Mg 2+ Hy-Taq 500U + dntps #EZ1012 500U Concentration: 5U/μl Contents: Hy-Taq DNA Polymerase 100μl 10xPCR Buffer(Mg 2+ Plus) 1.25ml dntps(2.5mm each) 1ml 6xLoading Buffer 1ml Store at -20 C For research only

More information

Reliable extraction of DNA from Whatman FTA cards

Reliable extraction of DNA from Whatman FTA cards Sample collection Reliable extraction of DNA from Whatman FTA cards This study examined the yield and quality of DNA from samples applied to Whatman FTA cards, using five common methods of DNA extraction.

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quest 5-hmC DNA ELISA Kit Catalog Nos. D5425 & D5426 Highlights Sensitive and specific quantitation of 5-hydroxymethylcytosine (5-hmC) DNA from a variety of samples. Ideal for global

More information

The Agilent Total RNA Isolation Kit

The Agilent Total RNA Isolation Kit Better RNA purity. Better data. Without DNase treatment. The Agilent Total RNA Isolation Kit Now you can isolate highly purified, intact RNA without DNase treatment Introducing the Agilent Total RNA Isolation

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

SOP for Quantitation of the Hepatitis C Virus (HCV) Genome by RT-PCR

SOP for Quantitation of the Hepatitis C Virus (HCV) Genome by RT-PCR Virus Bank SOP-HCV-001 1. Scope SOP for Quantitation of the Hepatitis C Virus (HCV) Genome by RT-PCR 1.1 This procedure describes a method for quantitation of the HCV genome in HCV-infected cells by RT-PCR.

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 214 Electronic Supplementary Information Construction of DNA logic gates utilizing an H + /Ag + induced

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Information Ultrasensitive and Selective DNA Detection Based on Nicking Endonuclease Assisted Signal Amplification and Its Application in Cancer Cells Detection Sai Bi, Jilei Zhang,

More information

E.Z.N.A. MicroElute Genomic DNA Kit. D preps D preps D preps

E.Z.N.A. MicroElute Genomic DNA Kit. D preps D preps D preps E.Z.N.A. MicroElute Genomic DNA Kit D3096-00 5 preps D3096-01 50 preps D3096-02 200 preps December 2013 E.Z.N.A. MicroElute Genomic DNA Kit Table of Contents Introduction...2 Kit Contents/Storage and Stability...3

More information

E.Z.N.A. Insect DNA Kit. D preps D preps D preps

E.Z.N.A. Insect DNA Kit. D preps D preps D preps E.Z.N.A. Insect DNA Kit D0926-00 5 preps D0926-01 50 preps D0926-02 200 preps May 2017 E.Z.N.A. Insect DNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing

More information

RNA-templated DNA origami structures

RNA-templated DNA origami structures Electronic Supplementary Information RNA-templated DNA origami structures Masayuki Endo,* a,c Seigi Yamamoto, b Koichi Tatsumi, b Tomoko Emura, b Kumi Hidaka, b and Hiroshi Sugiyama* a,b,c a Institute

More information

AmoyDx FFPE DNA Kit. (Spin Column) For purification of DNA from formalin-fixed, paraffin-embedded tissue sections. Instruction for Use

AmoyDx FFPE DNA Kit. (Spin Column) For purification of DNA from formalin-fixed, paraffin-embedded tissue sections. Instruction for Use AmoyDx FFPE DNA Kit (Spin Column) For purification of DNA from formalin-fixed, paraffin-embedded tissue sections Instruction for Use 8.0223501X036G 36 tests Amoy Diagnostics Co., Ltd. 39 Dingshan Road,

More information

mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification

mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification mrnadembeads Purification Mini Kit (cat #06011) Instruction manual for mrna purification Ademtech * Bioparc BioGalien 27 Allée Charles Darwin * 33600 Pessac France Tel : + 33 (0) 57 02 02 01, Fax : + 33

More information

HiChIP Protocol Mumbach et al. (CHANG), p. 1 Chang Lab, Stanford University. HiChIP Protocol

HiChIP Protocol Mumbach et al. (CHANG), p. 1 Chang Lab, Stanford University. HiChIP Protocol HiChIP Protocol Mumbach et al. (CHANG), p. 1 HiChIP Protocol Citation: Mumbach et. al., HiChIP: Efficient and sensitive analysis of protein-directed genome architecture. Nature Methods (2016). Cell Crosslinking

More information

rev. 05/31/12 Box 2 contains the following buffers/reagents:

rev. 05/31/12 Box 2 contains the following buffers/reagents: Store at RT, 4 C, and 20 C #9002 SimpleChIP Enzymatic Chromatin IP Kit (Agarose Beads) 3 n 1 Kit (30 Immunoprecipitations) For Research Use Only. Not For Use In Diagnostic Procedures. rev. 05/31/12 Orders

More information

Click Chemistry Capture Kit

Click Chemistry Capture Kit http://www.clickchemistrytools.com tel: 480 584 3340 fax: 866 717 2037 Click Chemistry Capture Kit Product No. 1065 Introduction The Click Chemistry Capture Kit provides all the necessary reagents* to

More information

GenElute Mammalian Genomic DNA Miniprep Kit

GenElute Mammalian Genomic DNA Miniprep Kit User Guide Catalog Nos. G1N10 G1N70 G1N350 GenElute Mammalian Genomic DNA Miniprep Kit sigma.com Ordering Information Catalog No. Product Description Pkg Size G1N10 GenElute Mammalian Genomic DNA Miniprep

More information

FMF NIRCA PROTOCOL STEP 1.

FMF NIRCA PROTOCOL STEP 1. FMF NIRCA PROTOCOL STEP 1. After you have isolated patient s DNA and DNA from a healthy donor (wild type), you perform a nested PCR. The primers used to amplify exon 2 and exon 10 of the mefv gene are

More information

E.Z.N.A. FFPE RNA Kit. R preps R preps R preps

E.Z.N.A. FFPE RNA Kit. R preps R preps R preps E.Z.N.A. FFPE RNA Kit R6954-00 5 preps R6954-01 50 preps R6954-02 200 preps January 2015 E.Z.N.A. FFPE RNA Kit Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing

More information

Thermo Scientific GeneJET Plant Genomic DNA Purification Mini Kit #K0791, #K0792

Thermo Scientific GeneJET Plant Genomic DNA Purification Mini Kit #K0791, #K0792 PRODUCT INFORMATION Thermo Scientific GeneJET Plant Genomic DNA Purification Mini Kit #K0791, #K0792 Pub. No. MAN0016131 Rev. Date 12 October 2016 (Rev. A.00) Read Storage information (p. 2) before first

More information

FFPE DNA Extraction kit

FFPE DNA Extraction kit FFPE DNA Extraction kit Instruction Manual FFPE DNA Extraction kit Cat. No. C20000030, Format 50 rxns Version 1 / 14.08.13 Content Introduction 4 Overview of FFPE DNA extraction workflow 4 Kit contents

More information

Preparation of Reduced Representation Bisulfite Sequencing (RRBS) libraries

Preparation of Reduced Representation Bisulfite Sequencing (RRBS) libraries Preparation of Reduced Representation Bisulfite Sequencing (RRBS) libraries Ambre Bender and Michael Weber CNRS University of Strasbourg UMR7242 Biotechnology and Cell signalling 300, Bd Sébastien Brant

More information

Click-&-Go TM Protein Enrichment Kit *for capture alkyne-modified proteins*

Click-&-Go TM Protein Enrichment Kit *for capture alkyne-modified proteins* Click-&-Go TM Protein Enrichment Kit *for capture alkyne-modified proteins* Product No. 1039 Introduction The Click-&-Go TM Protein Enrichment Kit is an efficient, biotin-streptavidin free tool for capture

More information

Berberine as a novel light-up i-motif fluorescence ligand and. its application to design molecular logic systems

Berberine as a novel light-up i-motif fluorescence ligand and. its application to design molecular logic systems Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) Berberine as a novel light-up i-motif fluorescence ligand

More information

E.Z.N.A. Stool DNA Kit. D preps D preps D preps

E.Z.N.A. Stool DNA Kit. D preps D preps D preps E.Z.N.A. Stool DNA Kit D4015-00 5 preps D4015-01 50 preps D4015-02 200 preps April 2013 E.Z.N.A. Stool DNA Kit Table of Contents Introduction and Overview...2 Illustrated Protocol...3 Kit Contents/Storage

More information

celldatasci.com/dnastorm DNAstorm DNA Isolation Kit for FFPE Tissue Samples 50 extractions (CD502)

celldatasci.com/dnastorm DNAstorm DNA Isolation Kit for FFPE Tissue Samples 50 extractions (CD502) celldatasci.com/dnastorm info@celldatasci.com DNAstorm DNA Isolation Kit for FFPE Tissue Samples 50 extractions (CD502) Support: Email: support@celldatasci.com Phone: 650.285.2376 (option 2) Toll-free:

More information

Mag-Bind Universal Pathogen 96 Kit. M x 96 preps M x 96 preps

Mag-Bind Universal Pathogen 96 Kit. M x 96 preps M x 96 preps M4029-00 1 x 96 preps M4029-01 4 x 96 preps August 2015 Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Preparing Reagents...4 Tissue Protocol...5 Serum/Stool Protocol...9

More information

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No

High Pure PCR Template Preparation Kit for preparation of 100 nucleic acid samples Cat. No for preparation of 100 nucleic acid samples Cat. No. 1 796 88 Principle Cells are lysed during a short incubation with Proteinase K in the presence of a chaotropic salt (guanidine HCl), which immediately

More information

E.Z.N.A. Plant RNA Kit. R preps R preps R preps

E.Z.N.A. Plant RNA Kit. R preps R preps R preps E.Z.N.A. Plant RNA Kit R6827-00 5 preps R6827-01 50 preps R6827-02 200 preps August 2014 E.Z.N.A. Plant RNA Kit Table of Contents Introduction...2 Illustrated Protocol...3 Kit Contents and Storage...4

More information

Microsatellite Library Protocol

Microsatellite Library Protocol Last Update 11/26/03 D Drown Modified from T. Garner Protocol Microsatellite Library Protocol Outline of Protocol DNA Extraction (1 overnight [optional], 3 hrs setup) Digestion and Size Fractionation (8

More information

MethylAffinity TM Methylated DNA Enrichment Kit For rapid purification and enrichment of methylated DNA. Cat.No.MAK-GCM-30 (30 reactions) User Manual

MethylAffinity TM Methylated DNA Enrichment Kit For rapid purification and enrichment of methylated DNA. Cat.No.MAK-GCM-30 (30 reactions) User Manual MethylAffinity TM Methylated DNA Enrichment Kit For rapid purification and enrichment of methylated DNA Cat.No.MAK-GCM-30 (30 reactions) User Manual GeneCopoeia, Inc. 9620 Medical Center Drive, #101 Rockville,

More information

E.Z.N.A. Plant RNA Kit. R preps R preps R preps

E.Z.N.A. Plant RNA Kit. R preps R preps R preps E.Z.N.A. Plant RNA Kit R6827-00 5 preps R6827-01 50 preps R6827-02 200 preps September 2014 E.Z.N.A. Plant RNA Kit Table of Contents Introduction...2 Illustrated Protocol...3 Kit Contents and Storage...4

More information

Puro. Knockout Detection (KOD) Kit

Puro. Knockout Detection (KOD) Kit Puro Knockout Detection (KOD) Kit Cat. No. CC-03 18 Oct. 2016 Contents I. Kit Contents and Storage II. Product Overview III. Methods Experimental Outline Genomic DNA Preparation Obtain Hybrid DNA Digest

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 26 69451 Weinheim, Germany A new homogenous assay for studying mira maturation Brian Patrick Davies and Christoph Arenz General Information For MALDI-TF measurements a

More information

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity

More information

Genomic DNA Mini Kit (Blood/Cultured Cell) For research use only

Genomic DNA Mini Kit (Blood/Cultured Cell) For research use only Genomic DNA Mini Kit (Blood/Cultured Cell) For research use only Sample : up to 300 µl of whole blood, up to 200 µl of frozen blood, up to 200 µl of buffy coat, cultured animal cells (up to 1 x 107), 9

More information

EPIGENTEK. Methylamp Whole Cell Bisulfite Modification Kit. Base Catalog # P-1016 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. Methylamp Whole Cell Bisulfite Modification Kit. Base Catalog # P-1016 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Methylamp Whole Cell Bisulfite Modification Kit Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The Methylamp Whole Cell Bisulfite Modification Kit is specifically designed for DNA methylation

More information

E.Z.N.A. Stool DNA Kit. D preps D preps D preps

E.Z.N.A. Stool DNA Kit. D preps D preps D preps E.Z.N.A. Stool DNA Kit D4015-00 5 preps D4015-01 50 preps D4015-02 200 preps July 2017 E.Z.N.A. Stool DNA Kit Table of Contents Introduction and Overview...2 Illustrated Protocol...3 Kit Contents/Storage

More information

For Research Use Only Ver

For Research Use Only Ver INSTRUCTION MANUAL Quick-DNA/RNA FFPE Kit Catalog No. R1009 Highlights High performance sample prep technology for total nucleic acid (DNA & RNA) recovery from the same FFPE tissue sample/section. High

More information

AmpliScribe T7-Flash Transcription Kit

AmpliScribe T7-Flash Transcription Kit AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction

More information

Protocol for DNA extraction from FFPE Samples

Protocol for DNA extraction from FFPE Samples 25, ave Georges Lemaître - B-6041 Gosselies (Belgique) Tel : +32 (0)71 37 85 27 - Fax : +32 (0)71 34 78 79 Protocol for DNA extraction from FFPE Samples Step 1. Paraffin Removal 1 Equilibrate a heat block

More information